Incidental Mutation 'R3889:Fsd1'
ID310215
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Namefibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission 040801-MU
Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55986511-55996881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55993893 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 251 (K251E)
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably benign
Transcript: ENSMUST00000011733
AA Change: K251E

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589
AA Change: K251E

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Meta Mutation Damage Score 0.1357 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55993943 critical splice donor site probably null
IGL01023:Fsd1 APN 17 55988245 missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55995363 missense probably benign
IGL02065:Fsd1 APN 17 55996499 missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55990244 splice site probably benign
IGL02515:Fsd1 APN 17 55996303 missense probably null 1.00
IGL02674:Fsd1 APN 17 55996483 missense probably benign 0.04
IGL03135:Fsd1 APN 17 55990416 splice site probably null
IGL03380:Fsd1 APN 17 55995456 missense probably benign 0.00
emboldened UTSW 17 55990542 critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55988199 missense probably benign 0.26
R0201:Fsd1 UTSW 17 55990522 missense probably benign 0.00
R0521:Fsd1 UTSW 17 55991245 missense probably benign
R0718:Fsd1 UTSW 17 55996445 unclassified probably null
R1077:Fsd1 UTSW 17 55990542 critical splice donor site probably null
R1519:Fsd1 UTSW 17 55993870 missense probably benign 0.14
R1696:Fsd1 UTSW 17 55988257 critical splice donor site probably null
R1867:Fsd1 UTSW 17 55991254 missense probably benign 0.00
R2173:Fsd1 UTSW 17 55991223 missense possibly damaging 0.64
R3950:Fsd1 UTSW 17 55995517 critical splice donor site probably null
R4787:Fsd1 UTSW 17 55996257 missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55991241 missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55996452 missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55990542 critical splice donor site probably benign
R5749:Fsd1 UTSW 17 55995849 splice site probably null
R7077:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7078:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7091:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7137:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55996696 missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55991356 missense probably benign 0.01
R7474:Fsd1 UTSW 17 55988149 missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55988150 missense probably benign 0.00
X0022:Fsd1 UTSW 17 55995464 nonsense probably null
Z1088:Fsd1 UTSW 17 55991203 missense probably damaging 0.98
Z1177:Fsd1 UTSW 17 55996083 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAAGGCGAGACTTGGTGTC -3'
(R):5'- GTTCCCTAGCAGCTAGAGTG -3'

Sequencing Primer
(F):5'- ACCTGCTGCTCTTACAGAGGAC -3'
(R):5'- CTAGCAGCTAGAGTGACCAGGTC -3'
Posted On2015-04-17