Mutagenetix > Incidental Mutation

Incidental Mutation 'R3907:Slc19a3'

310222

Institutional Source

Beutler Lab

Gene Symbol

Slc19a3

Ensembl Gene

ENSMUSG00000038496

Gene Name

solute carrier family 19, member 3

Synonyms

ThTr2, A230084E24Rik

MMRRC Submission

040908-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R3907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83012523-83038448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83014813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 396 (R396C)

Ref Sequence

ENSEMBL: ENSMUSP00000126646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]

AlphaFold

Q99PL8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045560
AA Change: R396C

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: R396C

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.4e-178	PFAM
Pfam:MFS_1	16	416	1.6e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142805

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164473
AA Change: R396C

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: R396C

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.3e-178	PFAM
Pfam:MFS_1	16	416	1.9e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189789

Meta Mutation Damage Score

0.1463

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Apba1	T	C	19: 23,937,506	I690T	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Ephb1	A	G	9: 102,001,726	C522R	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Shank2	C	T	7: 144,409,576	P307L	probably damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Slc19a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03066:Slc19a3	APN	1	83014836	missense	probably damaging	0.99
tag	UTSW	1	83026260	missense	probably damaging	1.00
R0437:Slc19a3	UTSW	1	83022565	missense	probably benign	0.00
R0526:Slc19a3	UTSW	1	83022733	missense	probably damaging	1.00
R1160:Slc19a3	UTSW	1	83022692	missense	possibly damaging	0.85
R1306:Slc19a3	UTSW	1	83022762	missense	probably damaging	1.00
R1832:Slc19a3	UTSW	1	83022747	missense	probably damaging	0.99
R1938:Slc19a3	UTSW	1	83019368	missense	possibly damaging	0.76
R1961:Slc19a3	UTSW	1	83022798	missense	probably benign	0.00
R2058:Slc19a3	UTSW	1	83014791	missense	probably damaging	0.98
R2200:Slc19a3	UTSW	1	83022943	missense	probably damaging	0.96
R2245:Slc19a3	UTSW	1	83013970	missense	possibly damaging	0.84
R2261:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R2404:Slc19a3	UTSW	1	83023035	missense	probably benign	0.16
R3891:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3892:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3912:Slc19a3	UTSW	1	83022703	missense	probably benign	0.09
R3922:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3923:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3961:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4083:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4106:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4107:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4109:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4667:Slc19a3	UTSW	1	83022799	missense	probably benign
R4768:Slc19a3	UTSW	1	83023113	missense	probably damaging	1.00
R4769:Slc19a3	UTSW	1	83019341	missense	probably damaging	1.00
R5001:Slc19a3	UTSW	1	83022620	missense	probably benign	0.33
R5538:Slc19a3	UTSW	1	83022561	missense	possibly damaging	0.51
R5588:Slc19a3	UTSW	1	83023055	nonsense	probably null
R6143:Slc19a3	UTSW	1	83026339	missense	probably benign	0.00
R6546:Slc19a3	UTSW	1	83026360	missense	probably benign	0.02
R6547:Slc19a3	UTSW	1	83022900	missense	probably damaging	1.00
R7059:Slc19a3	UTSW	1	83022369	missense	probably damaging	1.00
R7497:Slc19a3	UTSW	1	83013928	missense	probably damaging	1.00
R7509:Slc19a3	UTSW	1	83026260	missense	probably damaging	1.00
R7584:Slc19a3	UTSW	1	83022748	missense	possibly damaging	0.79
R7810:Slc19a3	UTSW	1	83019441	missense	probably benign	0.02
R8150:Slc19a3	UTSW	1	83022495	missense	probably damaging	1.00
R8412:Slc19a3	UTSW	1	83014812	missense	probably damaging	0.97
R8970:Slc19a3	UTSW	1	83023101	missense	probably damaging	1.00
R9314:Slc19a3	UTSW	1	83022373	missense	possibly damaging	0.62
R9671:Slc19a3	UTSW	1	83022576	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGAGGCAACCTGGTTATTC -3'
(R):5'- GGACATGCCTTAACAACACTG -3'

Sequencing Primer
(F):5'- GAGGCAACCTGGTTATTCTATATTCC -3'
(R):5'- GGCTAGGAATGGTCTTGAATCCCTC -3'

Posted On

2015-04-17