Incidental Mutation 'R3907:Mapkapk2'
List |< first << previous [record 35 of 62] next >> last >|
ID310224
Institutional Source Beutler Lab
Gene Symbol Mapkapk2
Ensembl Gene ENSMUSG00000016528
Gene NameMAP kinase-activated protein kinase 2
SynonymsMAPKAP kinase 2, Rps6kc1, MK2
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131053700-131097826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131056914 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 234 (S234T)
Ref Sequence ENSEMBL: ENSMUSP00000016672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016672] [ENSMUST00000188459]
Predicted Effect probably damaging
Transcript: ENSMUST00000016672
AA Change: S234T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016672
Gene: ENSMUSG00000016528
AA Change: S234T

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
S_TKc 50 311 1.26e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188459
AA Change: S155T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141124
Gene: ENSMUSG00000016528
AA Change: S155T

DomainStartEndE-ValueType
S_TKc 1 160 4.5e-4 SMART
Meta Mutation Damage Score 0.6539 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus affects the inflammatory response. Homozygous null mice show an increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Mapkapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Mapkapk2 APN 1 131058762 start codon destroyed probably null
R0015:Mapkapk2 UTSW 1 131097326 missense possibly damaging 0.79
R0318:Mapkapk2 UTSW 1 131097335 missense probably damaging 0.99
R1234:Mapkapk2 UTSW 1 131055776 nonsense probably null
R1755:Mapkapk2 UTSW 1 131058350 critical splice donor site probably null
R1765:Mapkapk2 UTSW 1 131058761 start codon destroyed probably null 0.09
R5949:Mapkapk2 UTSW 1 131058005 missense possibly damaging 0.95
R6838:Mapkapk2 UTSW 1 131058003 nonsense probably null
R7445:Mapkapk2 UTSW 1 131097519 missense unknown
R7802:Mapkapk2 UTSW 1 131056902 missense possibly damaging 0.51
R7839:Mapkapk2 UTSW 1 131097519 missense unknown
RF002:Mapkapk2 UTSW 1 131056513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAAGTGAAGCAGGAACTC -3'
(R):5'- TTGCACCCTAAGCTTGTAGC -3'

Sequencing Primer
(F):5'- TCAGAATTCCCAGGGAGCC -3'
(R):5'- GTAGCTGCAGAGTCCCTTCTG -3'
Posted On2015-04-17