Incidental Mutation 'R3907:Tmcc2'
List |< first << previous [record 54 of 62] next >> last >|
ID310225
Institutional Source Beutler Lab
Gene Symbol Tmcc2
Ensembl Gene ENSMUSG00000042066
Gene Nametransmembrane and coiled-coil domains 2
Synonyms1110063G11Rik
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132356315-132391281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132360638 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 359 (D359G)
Ref Sequence ENSEMBL: ENSMUSP00000118844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045473] [ENSMUST00000132435] [ENSMUST00000142609]
Predicted Effect probably damaging
Transcript: ENSMUST00000045473
AA Change: D437G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038369
Gene: ENSMUSG00000042066
AA Change: D437G

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 164 183 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
Pfam:Tmemb_cc2 283 694 6.3e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125439
Predicted Effect probably damaging
Transcript: ENSMUST00000132435
AA Change: D359G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118844
Gene: ENSMUSG00000042066
AA Change: D359G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 86 105 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
Pfam:Tmemb_cc2 203 617 1.1e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138717
Predicted Effect possibly damaging
Transcript: ENSMUST00000142609
AA Change: D202G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115721
Gene: ENSMUSG00000042066
AA Change: D202G

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Tmemb_cc2 46 460 2.2e-194 PFAM
Meta Mutation Damage Score 0.8584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Tmcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Tmcc2 APN 1 132380698 missense probably benign
IGL01991:Tmcc2 APN 1 132361092 missense probably benign 0.25
IGL02259:Tmcc2 APN 1 132361160 missense probably benign
IGL02310:Tmcc2 APN 1 132358907 missense probably damaging 1.00
IGL02551:Tmcc2 APN 1 132357579 missense probably damaging 1.00
IGL03301:Tmcc2 APN 1 132360819 missense possibly damaging 0.95
IGL03347:Tmcc2 APN 1 132357652 missense probably damaging 1.00
R0131:Tmcc2 UTSW 1 132380706 missense probably benign 0.10
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1538:Tmcc2 UTSW 1 132380980 missense probably damaging 0.98
R2428:Tmcc2 UTSW 1 132360831 missense probably damaging 1.00
R4890:Tmcc2 UTSW 1 132380779 missense probably benign 0.43
R5364:Tmcc2 UTSW 1 132357796 missense probably damaging 1.00
R5567:Tmcc2 UTSW 1 132357805 missense probably benign 0.01
R5596:Tmcc2 UTSW 1 132360483 missense probably damaging 1.00
R5916:Tmcc2 UTSW 1 132357691 missense probably damaging 0.98
R5931:Tmcc2 UTSW 1 132357755 small deletion probably benign
R6278:Tmcc2 UTSW 1 132358982 missense probably damaging 0.99
R7404:Tmcc2 UTSW 1 132361021 missense probably damaging 0.98
R7806:Tmcc2 UTSW 1 132360789 missense probably damaging 1.00
R7848:Tmcc2 UTSW 1 132360621 missense probably damaging 1.00
R7903:Tmcc2 UTSW 1 132360461 missense probably benign 0.00
R7931:Tmcc2 UTSW 1 132360621 missense probably damaging 1.00
R7986:Tmcc2 UTSW 1 132360461 missense probably benign 0.00
RF012:Tmcc2 UTSW 1 132361018 missense probably damaging 1.00
X0052:Tmcc2 UTSW 1 132360333 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAAAGAGTGTTGGATCTCGGGC -3'
(R):5'- CTACGCGATATGCAGCAAGG -3'

Sequencing Primer
(F):5'- TTGGATCTCGGGCTTCCCAG -3'
(R):5'- GGCTGAAGGATGTGGGC -3'
Posted On2015-04-17