Incidental Mutation 'R3907:Olfr1222'
List |< first << previous [record 39 of 62] next >> last >|
ID310230
Institutional Source Beutler Lab
Gene Symbol Olfr1222
Ensembl Gene ENSMUSG00000075101
Gene Nameolfactory receptor 1222
SynonymsMOR233-14, GA_x6K02T2Q125-50604368-50603433
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89122885-89133054 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 89125583 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 49 (Y49*)
Ref Sequence ENSEMBL: ENSMUSP00000150144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099794] [ENSMUST00000214027] [ENSMUST00000215816]
Predicted Effect probably null
Transcript: ENSMUST00000099794
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000097382
Gene: ENSMUSG00000075101
AA Change: Y49*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.3e-44 PFAM
Pfam:7tm_1 39 286 4.8e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137595
AA Change: Y49*
SMART Domains Protein: ENSMUSP00000120074
Gene: ENSMUSG00000075101
AA Change: Y49*

DomainStartEndE-ValueType
Pfam:7tm_1 39 217 1.9e-22 PFAM
Pfam:7tm_4 138 217 1.4e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214027
AA Change: Y49*
Predicted Effect probably null
Transcript: ENSMUST00000215816
AA Change: Y49*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Olfr1222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Olfr1222 APN 2 89125728 start codon destroyed probably null 1.00
IGL01876:Olfr1222 APN 2 89125737 unclassified probably null
IGL02090:Olfr1222 APN 2 89125677 missense probably benign 0.20
IGL03230:Olfr1222 APN 2 89125548 missense probably damaging 1.00
R4272:Olfr1222 UTSW 2 89125362 missense probably damaging 1.00
R4975:Olfr1222 UTSW 2 89125338 missense probably damaging 1.00
R4981:Olfr1222 UTSW 2 89125501 missense probably benign 0.02
R5466:Olfr1222 UTSW 2 89125133 missense probably benign 0.25
R5768:Olfr1222 UTSW 2 89125449 missense probably benign 0.01
R7296:Olfr1222 UTSW 2 89124836 missense probably benign 0.03
R7757:Olfr1222 UTSW 2 89124989 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AACTCCTGCAAAGAAGTGGC -3'
(R):5'- GCTGATTACTCAAAGAAAGCTGACTAC -3'

Sequencing Primer
(F):5'- GCTAGTAAACAGTTGTGTGATGCAAC -3'
(R):5'- CTCATTACTGCAGATTTTCATGAAC -3'
Posted On2015-04-17