Incidental Mutation 'R3907:Chrm4'
List |< first << previous [record 15 of 62] next >> last >|
ID310231
Institutional Source Beutler Lab
Gene Symbol Chrm4
Ensembl Gene ENSMUSG00000040495
Gene Namecholinergic receptor, muscarinic 4
SynonymsChrm-4, muscarinic acetylcholine receptor 4
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91927249-91928688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91927739 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 164 (A164V)
Ref Sequence ENSEMBL: ENSMUSP00000040808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028672] [ENSMUST00000045537] [ENSMUST00000069423] [ENSMUST00000090602] [ENSMUST00000111309]
Predicted Effect probably benign
Transcript: ENSMUST00000028672
SMART Domains Protein: ENSMUSP00000028672
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045537
AA Change: A164V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040808
Gene: ENSMUSG00000040495
AA Change: A164V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 248 5.7e-7 PFAM
Pfam:7tm_1 48 453 5.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069423
SMART Domains Protein: ENSMUSP00000068413
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090602
SMART Domains Protein: ENSMUSP00000088090
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111309
SMART Domains Protein: ENSMUSP00000106941
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Meta Mutation Damage Score 0.1847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, mouse studies link its function to adenylyl cyclase inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show decreased body weight, hyperactivity, abnormalities in carbamylcholine-induced bradycardia and gallbladder contractility, and altered CNS synaptic transmission. Mice homozygous for a different null allele show loss of the anti-cataleptic effect of scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Chrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Chrm4 APN 2 91927831 missense probably damaging 1.00
R0437:Chrm4 UTSW 2 91928443 missense possibly damaging 0.89
R0755:Chrm4 UTSW 2 91928402 missense probably benign 0.02
R1972:Chrm4 UTSW 2 91927493 missense probably benign 0.00
R2233:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2235:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2902:Chrm4 UTSW 2 91927957 missense probably benign 0.00
R3115:Chrm4 UTSW 2 91927360 missense probably benign 0.06
R4839:Chrm4 UTSW 2 91927607 missense probably damaging 1.00
R7033:Chrm4 UTSW 2 91928347 missense probably benign 0.01
R7242:Chrm4 UTSW 2 91927250 start codon destroyed probably null 0.86
R7707:Chrm4 UTSW 2 91927354 missense probably benign 0.01
R8066:Chrm4 UTSW 2 91927697 missense probably damaging 1.00
R8076:Chrm4 UTSW 2 91927859 missense probably damaging 1.00
R8293:Chrm4 UTSW 2 91928218 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACATCATCAAGGGCTACTGGC -3'
(R):5'- GATGCTTGTGAACACGGCTG -3'

Sequencing Primer
(F):5'- CTGTGACCTGTGGCTGGC -3'
(R):5'- GGCCAGCGAGATATGAATA -3'
Posted On2015-04-17