Incidental Mutation 'R3907:Ppp1r16b'
ID310234
Institutional Source Beutler Lab
Gene Symbol Ppp1r16b
Ensembl Gene ENSMUSG00000037754
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16B
SynonymsC130078N17Rik, Wdt4, ANKRD4
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158665398-158766334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158761490 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 345 (I345T)
Ref Sequence ENSEMBL: ENSMUSP00000117310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
Predicted Effect probably benign
Transcript: ENSMUST00000045503
AA Change: I445T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: I445T

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052927
AA Change: I445T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: I445T

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103116
AA Change: I445T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: I445T

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129902
Predicted Effect probably benign
Transcript: ENSMUST00000145073
AA Change: I345T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: I345T

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Ppp1r16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ppp1r16b APN 2 158756965 missense probably damaging 1.00
IGL01024:Ppp1r16b APN 2 158740816 splice site probably benign
IGL01080:Ppp1r16b APN 2 158757172 missense probably damaging 0.99
IGL02106:Ppp1r16b APN 2 158746531 missense possibly damaging 0.51
IGL03084:Ppp1r16b APN 2 158761493 nonsense probably null
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0190:Ppp1r16b UTSW 2 158696063 missense probably damaging 1.00
R0294:Ppp1r16b UTSW 2 158746603 missense probably damaging 1.00
R1735:Ppp1r16b UTSW 2 158761495 missense possibly damaging 0.94
R1746:Ppp1r16b UTSW 2 158746665 critical splice donor site probably null
R1847:Ppp1r16b UTSW 2 158761435 missense probably damaging 0.99
R2297:Ppp1r16b UTSW 2 158761366 missense possibly damaging 0.88
R2509:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R2923:Ppp1r16b UTSW 2 158756957 missense probably damaging 1.00
R4344:Ppp1r16b UTSW 2 158749186 missense probably damaging 1.00
R4373:Ppp1r16b UTSW 2 158761765 missense probably damaging 1.00
R4423:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4424:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4425:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4623:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R5436:Ppp1r16b UTSW 2 158757333 intron probably benign
R6029:Ppp1r16b UTSW 2 158755217 missense possibly damaging 0.74
R6119:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
R6816:Ppp1r16b UTSW 2 158761675 missense probably benign 0.00
R6941:Ppp1r16b UTSW 2 158696148 missense probably damaging 1.00
R7048:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R7101:Ppp1r16b UTSW 2 158761763 missense probably damaging 1.00
R7255:Ppp1r16b UTSW 2 158761391 missense probably benign 0.41
R7490:Ppp1r16b UTSW 2 158761468 missense probably damaging 0.99
X0064:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGATGATACTGATGCTATCCTC -3'
(R):5'- TTCTGCCTCCAATCAAGGGG -3'

Sequencing Primer
(F):5'- GATGATACTGATGCTATCCTCTTGTC -3'
(R):5'- GGCCTTGCCTTCGCTGC -3'
Posted On2015-04-17