Incidental Mutation 'R3907:Csf3r'
ID 310237
Institutional Source Beutler Lab
Gene Symbol Csf3r
Ensembl Gene ENSMUSG00000028859
Gene Name colony stimulating factor 3 receptor (granulocyte)
Synonyms G-CSFR, Cd114, Csfgr
MMRRC Submission 040908-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.486) question?
Stock # R3907 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126024550-126044440 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126034447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 291 (D291V)
Ref Sequence ENSEMBL: ENSMUSP00000101768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000106162]
AlphaFold P40223
Predicted Effect probably benign
Transcript: ENSMUST00000030673
AA Change: D291V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: D291V

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 24 111 2.3e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106162
AA Change: D291V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: D291V

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 22 112 6.8e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153968
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Csf3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Csf3r APN 4 126032127 nonsense probably null
IGL02224:Csf3r APN 4 126043539 missense probably benign 0.36
IGL02558:Csf3r APN 4 126038135 splice site probably benign
R0026:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0121:Csf3r UTSW 4 126029849 missense probably benign 0.01
R0413:Csf3r UTSW 4 126039667 splice site probably benign
R0456:Csf3r UTSW 4 126035861 missense probably damaging 0.98
R0479:Csf3r UTSW 4 126043823 missense probably damaging 0.98
R1052:Csf3r UTSW 4 126042988 splice site probably null
R1466:Csf3r UTSW 4 126031932 splice site probably benign
R1512:Csf3r UTSW 4 126029984 missense possibly damaging 0.75
R1902:Csf3r UTSW 4 126042918 missense probably damaging 1.00
R1905:Csf3r UTSW 4 126042745 missense probably benign 0.12
R2520:Csf3r UTSW 4 126035352 missense probably benign 0.06
R3424:Csf3r UTSW 4 126043756 missense probably damaging 1.00
R3705:Csf3r UTSW 4 126032285 missense possibly damaging 0.76
R4514:Csf3r UTSW 4 126039860 missense possibly damaging 0.61
R4817:Csf3r UTSW 4 126037656 nonsense probably null
R5111:Csf3r UTSW 4 126030068 splice site probably null
R5120:Csf3r UTSW 4 126035827 missense probably benign 0.00
R5308:Csf3r UTSW 4 126035344 missense probably benign 0.00
R5912:Csf3r UTSW 4 126029960 missense probably damaging 1.00
R6018:Csf3r UTSW 4 126043621 missense probably benign 0.01
R6024:Csf3r UTSW 4 126037517 splice site probably null
R7144:Csf3r UTSW 4 126043722 missense probably benign 0.03
R7615:Csf3r UTSW 4 126037656 nonsense probably null
R7717:Csf3r UTSW 4 126037610 missense probably damaging 1.00
R8443:Csf3r UTSW 4 126029919 missense possibly damaging 0.77
R8935:Csf3r UTSW 4 126043407 missense probably benign 0.00
R9131:Csf3r UTSW 4 126030020 missense probably benign
R9383:Csf3r UTSW 4 126043446 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATGTAGTCTCTCACCAGCCTGG -3'
(R):5'- GTCCTGAACTGAGCTCTGAAGG -3'

Sequencing Primer
(F):5'- TGGAAGCCATGGAAGCCC -3'
(R):5'- GAACTGAGCTCTGAAGGCTTCTC -3'
Posted On 2015-04-17