Incidental Mutation 'R3907:Asns'
List |< first << previous [record 8 of 62] next >> last >|
ID310241
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Nameasparagine synthetase
Synonyms
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7675169-7693254 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 7682270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303] [ENSMUST00000139596] [ENSMUST00000148349]
Predicted Effect probably null
Transcript: ENSMUST00000031766
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115542
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126303
SMART Domains Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 28 160 1.3e-24 PFAM
Pfam:GATase_7 47 166 3.1e-29 PFAM
Pfam:DUF3700 67 180 6.3e-10 PFAM
Pfam:GATase_2 89 161 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133972
Predicted Effect probably benign
Transcript: ENSMUST00000139596
SMART Domains Protein: ENSMUSP00000120489
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 26 157 7e-25 PFAM
Pfam:GATase_7 47 157 1e-27 PFAM
Pfam:DUF3700 66 158 5.7e-9 PFAM
Pfam:GATase_2 89 158 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Predicted Effect probably benign
Transcript: ENSMUST00000148349
SMART Domains Protein: ENSMUSP00000118003
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 24 127 1.4e-17 PFAM
Pfam:GATase_7 47 127 2.6e-18 PFAM
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7680179 missense probably damaging 1.00
IGL00656:Asns APN 6 7680215 unclassified probably benign
IGL01534:Asns APN 6 7675397 missense probably benign 0.03
IGL01996:Asns APN 6 7682378 missense possibly damaging 0.56
IGL02058:Asns APN 6 7685184 missense probably damaging 1.00
IGL02311:Asns APN 6 7676233 critical splice donor site probably null
IGL02367:Asns APN 6 7685411 splice site probably benign
IGL03263:Asns APN 6 7689404 missense probably benign 0.07
IGL03341:Asns APN 6 7682002 missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7689277 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0050:Asns UTSW 6 7676019 missense probably benign 0.02
R0627:Asns UTSW 6 7675516 missense probably benign 0.05
R1075:Asns UTSW 6 7676076 nonsense probably null
R1591:Asns UTSW 6 7678007 missense probably damaging 0.97
R2047:Asns UTSW 6 7680093 missense probably damaging 0.99
R2232:Asns UTSW 6 7689316 missense possibly damaging 0.82
R2907:Asns UTSW 6 7675506 missense probably benign 0.03
R4373:Asns UTSW 6 7677978 missense probably damaging 0.98
R4438:Asns UTSW 6 7675320 missense probably benign 0.15
R4660:Asns UTSW 6 7678012 missense probably benign 0.05
R4784:Asns UTSW 6 7678029 missense probably benign 0.12
R5655:Asns UTSW 6 7685309 missense probably benign 0.31
R5752:Asns UTSW 6 7689365 missense probably damaging 1.00
R5863:Asns UTSW 6 7675443 nonsense probably null
R5864:Asns UTSW 6 7675443 nonsense probably null
R5953:Asns UTSW 6 7682285 missense probably benign 0.00
R6773:Asns UTSW 6 7676284 missense probably benign 0.01
R6789:Asns UTSW 6 7675344 missense probably benign
R7389:Asns UTSW 6 7689291 missense probably damaging 1.00
R7524:Asns UTSW 6 7677259 synonymous probably null
R7783:Asns UTSW 6 7677978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCAAGCAGTCTACTACATC -3'
(R):5'- GCAGAGAAGCACCTAATTGC -3'

Sequencing Primer
(F):5'- GGCAAGCAGTCTACTACATCATTGTG -3'
(R):5'- GAGAAGCACCTAATTGCATACGTTG -3'
Posted On2015-04-17