Incidental Mutation 'R3907:Prrt4'
List |< first << previous [record 44 of 62] next >> last >|
ID310243
Institutional Source Beutler Lab
Gene Symbol Prrt4
Ensembl Gene ENSMUSG00000079654
Gene Nameproline-rich transmembrane protein 4
Synonyms
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29169232-29179584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29177174 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 199 (L199M)
Ref Sequence ENSEMBL: ENSMUSP00000123751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159200]
Predicted Effect probably damaging
Transcript: ENSMUST00000159200
AA Change: L199M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123751
Gene: ENSMUSG00000079654
AA Change: L199M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 152 171 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 504 521 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 678 702 N/A INTRINSIC
low complexity region 784 824 N/A INTRINSIC
low complexity region 838 854 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Prrt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Prrt4 APN 6 29176456 missense probably benign 0.33
IGL01585:Prrt4 APN 6 29177690 missense probably benign 0.05
IGL03015:Prrt4 APN 6 29169997 missense probably benign 0.27
R0143:Prrt4 UTSW 6 29170671 missense probably damaging 1.00
R0586:Prrt4 UTSW 6 29171184 missense probably damaging 1.00
R1052:Prrt4 UTSW 6 29169814 missense possibly damaging 0.66
R1391:Prrt4 UTSW 6 29169951 missense possibly damaging 0.90
R4239:Prrt4 UTSW 6 29170164 missense probably damaging 0.97
R4829:Prrt4 UTSW 6 29177182 missense probably benign 0.01
R5070:Prrt4 UTSW 6 29177512 missense probably benign
R5825:Prrt4 UTSW 6 29177183 missense probably benign 0.31
R6023:Prrt4 UTSW 6 29176453 missense probably benign
R6776:Prrt4 UTSW 6 29176552 missense possibly damaging 0.95
R6860:Prrt4 UTSW 6 29170738 missense possibly damaging 0.90
R6984:Prrt4 UTSW 6 29171430 missense probably benign 0.18
R7032:Prrt4 UTSW 6 29170539 missense possibly damaging 0.93
R7033:Prrt4 UTSW 6 29171148 missense possibly damaging 0.89
R7444:Prrt4 UTSW 6 29176517 missense probably benign
R7689:Prrt4 UTSW 6 29177141 missense probably damaging 0.97
R7711:Prrt4 UTSW 6 29177456 missense probably benign 0.00
R7735:Prrt4 UTSW 6 29170036 missense possibly damaging 0.90
R7748:Prrt4 UTSW 6 29177191 missense probably damaging 1.00
R7775:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7778:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7850:Prrt4 UTSW 6 29176901 critical splice donor site probably null
R7880:Prrt4 UTSW 6 29170156 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAAACTTGGATGTGCTGTTG -3'
(R):5'- CTGCTCACTCTCAACCTAGG -3'

Sequencing Primer
(F):5'- AACTCTGCCTTGAGAAGTTCCGG -3'
(R):5'- TCACTCTCAACCTAGGATGGG -3'
Posted On2015-04-17