Incidental Mutation 'R3907:Mxd1'
ID 310244
Institutional Source Beutler Lab
Gene Symbol Mxd1
Ensembl Gene ENSMUSG00000001156
Gene Name MAX dimerization protein 1
Synonyms Mad1, Mad
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock # R3907 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 86647042-86669161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86650960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 199 (Q199K)
Ref Sequence ENSEMBL: ENSMUSP00000001184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001184] [ENSMUST00000203946] [ENSMUST00000204437]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000001184
AA Change: Q199K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001184
Gene: ENSMUSG00000001156
AA Change: Q199K

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 6e-7 PDB
HLH 61 113 1.14e-9 SMART
low complexity region 143 175 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203946
SMART Domains Protein: ENSMUSP00000145081
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
HLH 6 58 4.8e-12 SMART
low complexity region 88 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204437
SMART Domains Protein: ENSMUSP00000145396
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 3e-8 PDB
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myelopoiesis, increased proliferative potential of bone marrow granulocytic precursors, increased sensitivity of myeloid cells to apoptosis-inducing stimuli, and inhibited cell cycle withdrawal during a late stage of granulocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Mxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Mxd1 UTSW 6 86667406 intron probably benign
R1385:Mxd1 UTSW 6 86651567 missense probably damaging 0.96
R1510:Mxd1 UTSW 6 86653155 missense possibly damaging 0.96
R1595:Mxd1 UTSW 6 86651471 missense possibly damaging 0.93
R2126:Mxd1 UTSW 6 86651440 critical splice donor site probably null
R3905:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R3909:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R6048:Mxd1 UTSW 6 86650984 missense probably damaging 1.00
R7060:Mxd1 UTSW 6 86653159 missense probably damaging 1.00
R7351:Mxd1 UTSW 6 86651466 missense probably damaging 1.00
R8969:Mxd1 UTSW 6 86651484 missense probably benign 0.04
R9315:Mxd1 UTSW 6 86650944 missense probably damaging 1.00
R9711:Mxd1 UTSW 6 86668572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGTGGACAGAGCTGC -3'
(R):5'- TCTGTAAGAGTTAGGTAGCCAAGC -3'

Sequencing Primer
(F):5'- CAGAGCTGCTATTGGTCAAGG -3'
(R):5'- TTAGGTAGCCAAGCCCAAGG -3'
Posted On 2015-04-17