Mutagenetix > Incidental Mutations

Incidental Mutation 'R3907:Mxd1'

310244

Institutional Source

Beutler Lab

Gene Symbol

Mxd1

Ensembl Gene

ENSMUSG00000001156

Gene Name

MAX dimerization protein 1

Synonyms

Mad1, Mad

MMRRC Submission

040908-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.493) question?

Stock #

R3907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86647042-86669161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86650960 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 199 (Q199K)

Ref Sequence

ENSEMBL: ENSMUSP00000001184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001184] [ENSMUST00000203946] [ENSMUST00000204437]

Predicted Effect

probably benign
Transcript: ENSMUST00000001184
AA Change: Q199K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000001184
Gene: ENSMUSG00000001156
AA Change: Q199K

Domain	Start	End	E-Value	Type
PDB:1PD7\|B	5	28	6e-7	PDB
HLH	61	113	1.14e-9	SMART
low complexity region	143	175	N/A	INTRINSIC
low complexity region	181	197	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203946

SMART Domains

Protein: ENSMUSP00000145081
Gene: ENSMUSG00000001156

Domain	Start	End	E-Value	Type
HLH	6	58	4.8e-12	SMART
low complexity region	88	104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204437

SMART Domains

Protein: ENSMUSP00000145396
Gene: ENSMUSG00000001156

Domain	Start	End	E-Value	Type
PDB:1PD7\|B	5	28	3e-8	PDB

Meta Mutation Damage Score

0.1005

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myelopoiesis, increased proliferative potential of bone marrow granulocytic precursors, increased sensitivity of myeloid cells to apoptosis-inducing stimuli, and inhibited cell cycle withdrawal during a late stage of granulocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Apba1	T	C	19: 23,937,506	I690T	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Ephb1	A	G	9: 102,001,726	C522R	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Shank2	C	T	7: 144,409,576	P307L	probably damaging	Het
Slc19a3	G	A	1: 83,014,813	R396C	possibly damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Mxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
LCD18:Mxd1	UTSW	6	86667406	intron	probably benign
R1385:Mxd1	UTSW	6	86651567	missense	probably damaging	0.96
R1510:Mxd1	UTSW	6	86653155	missense	possibly damaging	0.96
R1595:Mxd1	UTSW	6	86651471	missense	possibly damaging	0.93
R2126:Mxd1	UTSW	6	86651440	critical splice donor site	probably null
R3905:Mxd1	UTSW	6	86650960	missense	probably benign	0.44
R3909:Mxd1	UTSW	6	86650960	missense	probably benign	0.44
R6048:Mxd1	UTSW	6	86650984	missense	probably damaging	1.00
R7060:Mxd1	UTSW	6	86653159	missense	probably damaging	1.00
R7351:Mxd1	UTSW	6	86651466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAAGTGGACAGAGCTGC -3'
(R):5'- TCTGTAAGAGTTAGGTAGCCAAGC -3'

Sequencing Primer
(F):5'- CAGAGCTGCTATTGGTCAAGG -3'
(R):5'- TTAGGTAGCCAAGCCCAAGG -3'

Posted On

2015-04-17