Incidental Mutation 'R3907:Olfr5'
List |< first << previous [record 40 of 62] next >> last >|
ID310247
Institutional Source Beutler Lab
Gene Symbol Olfr5
Ensembl Gene ENSMUSG00000096228
Gene Nameolfactory receptor 5
SynonymsMOR103-8, GA_x6K02T2QGBW-3210997-3210059
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6478322-6486941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6480679 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 159 (V159D)
Ref Sequence ENSEMBL: ENSMUSP00000147586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086318] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]
Predicted Effect probably damaging
Transcript: ENSMUST00000086318
AA Change: V159D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228
AA Change: V159D

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207658
Predicted Effect probably damaging
Transcript: ENSMUST00000209866
AA Change: V159D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215302
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Olfr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr5 APN 7 6480998 missense probably benign
IGL02174:Olfr5 APN 7 6480439 missense probably benign
IGL03260:Olfr5 APN 7 6480659 missense probably damaging 0.99
IGL03411:Olfr5 APN 7 6480436 missense probably benign 0.26
R1186:Olfr5 UTSW 7 6480542 missense probably benign 0.00
R1381:Olfr5 UTSW 7 6481009 unclassified probably null
R1981:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R1982:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R3876:Olfr5 UTSW 7 6481132 missense probably benign 0.01
R4422:Olfr5 UTSW 7 6481038 nonsense probably null
R4654:Olfr5 UTSW 7 6481046 missense probably benign 0.00
R5605:Olfr5 UTSW 7 6480326 missense probably benign 0.00
R6962:Olfr5 UTSW 7 6481009 missense probably benign 0.07
R7524:Olfr5 UTSW 7 6480587 missense probably benign 0.04
R7576:Olfr5 UTSW 7 6480331 missense probably damaging 0.97
R8306:Olfr5 UTSW 7 6480869 missense possibly damaging 0.83
Z1177:Olfr5 UTSW 7 6480873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATAGTCGTGAGGAAGCAACC -3'
(R):5'- CATGGGGCTATGGAATGGACTC -3'

Sequencing Primer
(F):5'- CCCCAAAGGATGACAATGGCTG -3'
(R):5'- TCATAGCTTGTATGACCCAACTC -3'
Posted On2015-04-17