Mutagenetix > Incidental Mutation

Incidental Mutation 'R3907:Otoa'

310252

Institutional Source

Beutler Lab

Gene Symbol

Otoa

Ensembl Gene

ENSMUSG00000034990

Gene Name

otoancorin

Synonyms

MMRRC Submission

040908-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121081650-121163097 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121125565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 489 (Q489L)

Ref Sequence

ENSEMBL: ENSMUSP00000044177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]

AlphaFold

Q8K561

Predicted Effect

probably damaging
Transcript: ENSMUST00000047025
AA Change: Q489L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: Q489L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Meta Mutation Damage Score

0.2093

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Apba1	T	C	19: 23,937,506	I690T	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Ephb1	A	G	9: 102,001,726	C522R	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Shank2	C	T	7: 144,409,576	P307L	probably damaging	Het
Slc19a3	G	A	1: 83,014,813	R396C	possibly damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Otoa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Otoa	APN	7	121155273	critical splice donor site	probably null
IGL01791:Otoa	APN	7	121155849	missense	probably benign	0.25
IGL01924:Otoa	APN	7	121105968	missense	probably damaging	0.99
IGL01953:Otoa	APN	7	121160325	splice site	probably null
IGL02121:Otoa	APN	7	121122024	missense	probably benign	0.06
IGL02303:Otoa	APN	7	121132924	critical splice donor site	probably null
IGL02390:Otoa	APN	7	121131367	missense	possibly damaging	0.84
IGL02591:Otoa	APN	7	121155830	missense	probably damaging	1.00
IGL02811:Otoa	APN	7	121118655	missense	possibly damaging	0.60
IGL02878:Otoa	APN	7	121143853	missense	probably damaging	1.00
IGL03328:Otoa	APN	7	121110994	missense	probably damaging	0.98
R0056:Otoa	UTSW	7	121131347	missense	probably benign	0.00
R0279:Otoa	UTSW	7	121111079	splice site	probably benign
R0390:Otoa	UTSW	7	121131341	missense	probably benign	0.07
R0411:Otoa	UTSW	7	121156527	critical splice donor site	probably null
R0628:Otoa	UTSW	7	121145650	splice site	probably benign
R1113:Otoa	UTSW	7	121125443	nonsense	probably null
R1240:Otoa	UTSW	7	121156490	missense	probably benign
R1308:Otoa	UTSW	7	121125443	nonsense	probably null
R1692:Otoa	UTSW	7	121091551	missense	probably damaging	0.99
R1728:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1729:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1744:Otoa	UTSW	7	121127776	splice site	probably benign
R1759:Otoa	UTSW	7	121134103	missense	probably damaging	1.00
R1784:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1817:Otoa	UTSW	7	121160530	utr 3 prime	probably benign
R1961:Otoa	UTSW	7	121118569	missense	probably benign	0.05
R2061:Otoa	UTSW	7	121131328	missense	probably damaging	1.00
R2509:Otoa	UTSW	7	121160472	missense	probably benign
R2510:Otoa	UTSW	7	121160472	missense	probably benign
R3411:Otoa	UTSW	7	121122043	missense	probably damaging	1.00
R3438:Otoa	UTSW	7	121160343	missense	possibly damaging	0.80
R3905:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R4613:Otoa	UTSW	7	121145568	missense	probably damaging	1.00
R4751:Otoa	UTSW	7	121132924	critical splice donor site	probably benign
R4896:Otoa	UTSW	7	121102679	missense	probably damaging	1.00
R4932:Otoa	UTSW	7	121155135	missense	probably damaging	0.98
R5224:Otoa	UTSW	7	121139793	missense	probably damaging	0.98
R5235:Otoa	UTSW	7	121156470	missense	probably damaging	1.00
R5595:Otoa	UTSW	7	121121977	missense	probably damaging	1.00
R5891:Otoa	UTSW	7	121132360	splice site	probably null
R5894:Otoa	UTSW	7	121121869	missense	probably damaging	1.00
R5905:Otoa	UTSW	7	121094601	missense	probably damaging	1.00
R5976:Otoa	UTSW	7	121127713	missense	probably benign	0.00
R6464:Otoa	UTSW	7	121102605	missense	probably damaging	1.00
R6761:Otoa	UTSW	7	121121950	missense	probably damaging	1.00
R6770:Otoa	UTSW	7	121145614	missense	probably benign	0.25
R6821:Otoa	UTSW	7	121092847	critical splice donor site	probably null
R6924:Otoa	UTSW	7	121131501	splice site	probably null
R7016:Otoa	UTSW	7	121147766	missense	probably damaging	0.99
R7215:Otoa	UTSW	7	121118572	missense	unknown
R7313:Otoa	UTSW	7	121102542	missense	probably benign	0.42
R7340:Otoa	UTSW	7	121130065	missense	probably benign	0.38
R7443:Otoa	UTSW	7	121132410	missense	probably benign	0.00
R7559:Otoa	UTSW	7	121143926	missense	probably damaging	0.99
R7640:Otoa	UTSW	7	121145626	missense	probably damaging	1.00
R7654:Otoa	UTSW	7	121147700	missense	probably damaging	1.00
R7659:Otoa	UTSW	7	121134044	missense	probably benign	0.01
R8421:Otoa	UTSW	7	121099268	critical splice donor site	probably null
R8799:Otoa	UTSW	7	121092671	missense	possibly damaging	0.56
R8954:Otoa	UTSW	7	121145518	nonsense	probably null
R9099:Otoa	UTSW	7	121139832	missense	probably benign
R9126:Otoa	UTSW	7	121094622	missense	probably damaging	1.00
R9369:Otoa	UTSW	7	121145617	missense	probably benign	0.23
U24488:Otoa	UTSW	7	121118540	critical splice acceptor site	probably null
X0023:Otoa	UTSW	7	121118571	missense	probably benign	0.00
Z1177:Otoa	UTSW	7	121118655	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAGAGCGTCCTCATGACTG -3'
(R):5'- CGTGGTAAGAGGAACTATGTCTG -3'

Sequencing Primer
(F):5'- AGAGCGTCCTCATGACTGTTTCTC -3'
(R):5'- GAGACAAGGCAGCACTCCTG -3'

Posted On

2015-04-17