Incidental Mutation 'R3907:Otoa'
List |< first << previous [record 41 of 62] next >> last >|
ID310252
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Nameotoancorin
Synonyms
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121081650-121163097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121125565 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 489 (Q489L)
Ref Sequence ENSEMBL: ENSMUSP00000044177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]
Predicted Effect probably damaging
Transcript: ENSMUST00000047025
AA Change: Q489L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: Q489L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Meta Mutation Damage Score 0.2093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 121155273 critical splice donor site probably null
IGL01791:Otoa APN 7 121155849 missense probably benign 0.25
IGL01924:Otoa APN 7 121105968 missense probably damaging 0.99
IGL01953:Otoa APN 7 121160325 splice site probably null
IGL02121:Otoa APN 7 121122024 missense probably benign 0.06
IGL02303:Otoa APN 7 121132924 critical splice donor site probably null
IGL02390:Otoa APN 7 121131367 missense possibly damaging 0.84
IGL02591:Otoa APN 7 121155830 missense probably damaging 1.00
IGL02811:Otoa APN 7 121118655 missense possibly damaging 0.60
IGL02878:Otoa APN 7 121143853 missense probably damaging 1.00
IGL03328:Otoa APN 7 121110994 missense probably damaging 0.98
R0056:Otoa UTSW 7 121131347 missense probably benign 0.00
R0279:Otoa UTSW 7 121111079 splice site probably benign
R0390:Otoa UTSW 7 121131341 missense probably benign 0.07
R0411:Otoa UTSW 7 121156527 critical splice donor site probably null
R0628:Otoa UTSW 7 121145650 splice site probably benign
R1113:Otoa UTSW 7 121125443 nonsense probably null
R1240:Otoa UTSW 7 121156490 missense probably benign
R1308:Otoa UTSW 7 121125443 nonsense probably null
R1692:Otoa UTSW 7 121091551 missense probably damaging 0.99
R1728:Otoa UTSW 7 121125439 missense probably benign 0.36
R1729:Otoa UTSW 7 121125439 missense probably benign 0.36
R1744:Otoa UTSW 7 121127776 splice site probably benign
R1759:Otoa UTSW 7 121134103 missense probably damaging 1.00
R1784:Otoa UTSW 7 121125439 missense probably benign 0.36
R1817:Otoa UTSW 7 121160530 utr 3 prime probably benign
R1961:Otoa UTSW 7 121118569 missense probably benign 0.05
R2061:Otoa UTSW 7 121131328 missense probably damaging 1.00
R2509:Otoa UTSW 7 121160472 missense probably benign
R2510:Otoa UTSW 7 121160472 missense probably benign
R3411:Otoa UTSW 7 121122043 missense probably damaging 1.00
R3438:Otoa UTSW 7 121160343 missense possibly damaging 0.80
R3905:Otoa UTSW 7 121125565 missense probably damaging 1.00
R4613:Otoa UTSW 7 121145568 missense probably damaging 1.00
R4751:Otoa UTSW 7 121132924 critical splice donor site probably benign
R4896:Otoa UTSW 7 121102679 missense probably damaging 1.00
R4932:Otoa UTSW 7 121155135 missense probably damaging 0.98
R5224:Otoa UTSW 7 121139793 missense probably damaging 0.98
R5235:Otoa UTSW 7 121156470 missense probably damaging 1.00
R5595:Otoa UTSW 7 121121977 missense probably damaging 1.00
R5891:Otoa UTSW 7 121132360 splice site probably null
R5894:Otoa UTSW 7 121121869 missense probably damaging 1.00
R5905:Otoa UTSW 7 121094601 missense probably damaging 1.00
R5976:Otoa UTSW 7 121127713 missense probably benign 0.00
R6464:Otoa UTSW 7 121102605 missense probably damaging 1.00
R6761:Otoa UTSW 7 121121950 missense probably damaging 1.00
R6770:Otoa UTSW 7 121145614 missense probably benign 0.25
R6821:Otoa UTSW 7 121092847 critical splice donor site probably null
R6924:Otoa UTSW 7 121131501 intron probably null
R7016:Otoa UTSW 7 121147766 missense probably damaging 0.99
R7215:Otoa UTSW 7 121118572 missense unknown
R7313:Otoa UTSW 7 121102542 missense probably benign 0.42
R7340:Otoa UTSW 7 121130065 missense probably benign 0.38
R7443:Otoa UTSW 7 121132410 missense probably benign 0.00
R7559:Otoa UTSW 7 121143926 missense probably damaging 0.99
R7640:Otoa UTSW 7 121145626 missense probably damaging 1.00
R7654:Otoa UTSW 7 121147700 missense probably damaging 1.00
R7659:Otoa UTSW 7 121134044 missense probably benign 0.01
U24488:Otoa UTSW 7 121118540 critical splice acceptor site probably null
X0023:Otoa UTSW 7 121118571 missense probably benign 0.00
Z1177:Otoa UTSW 7 121118655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGAGCGTCCTCATGACTG -3'
(R):5'- CGTGGTAAGAGGAACTATGTCTG -3'

Sequencing Primer
(F):5'- AGAGCGTCCTCATGACTGTTTCTC -3'
(R):5'- GAGACAAGGCAGCACTCCTG -3'
Posted On2015-04-17