Incidental Mutation 'R3907:Shank2'
List |< first << previous [record 49 of 62] next >> last >|
ID310253
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score212
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144409576 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 307 (P307L)
Ref Sequence ENSEMBL: ENSMUSP00000146440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]
Predicted Effect probably damaging
Transcript: ENSMUST00000097929
AA Change: P300L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: P300L

DomainStartEndE-ValueType
PDZ 46 131 1.75e-14 SMART
low complexity region 135 154 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 814 828 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 915 937 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
low complexity region 1077 1091 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
SAM 1196 1262 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105900
AA Change: P517L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: P517L

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105902
AA Change: P886L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: P886L

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125355
Predicted Effect probably damaging
Transcript: ENSMUST00000146006
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1914 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGTCTGAGTCTGTGGAAAC -3'
(R):5'- TGAGTCCAGGGAAAATCTGTCC -3'

Sequencing Primer
(F):5'- TGGAAACACAGTGTATTACACAGTCC -3'
(R):5'- GGGAAAATCTGTCCAGCTCTC -3'
Posted On2015-04-17