Mutagenetix > Incidental Mutation

Incidental Mutation 'R3907:Ephb1'

310256

Institutional Source

Beutler Lab

Gene Symbol

Ephb1

Ensembl Gene

ENSMUSG00000032537

Gene Name

Eph receptor B1

Synonyms

Cek6, Net, C130099E04Rik, Hek6, Elk, Elkh

MMRRC Submission

040908-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3907 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

101922128-102354693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102001726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 522 (C522R)

Ref Sequence

ENSEMBL: ENSMUSP00000082261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169]

AlphaFold

Q8CBF3

Predicted Effect

probably benign
Transcript: ENSMUST00000035129
AA Change: C522R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: C522R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
EPH_lbd	19	196	1.69e-129	SMART
FN3	323	416	2.44e-5	SMART
FN3	434	515	2.26e-9	SMART
Pfam:EphA2_TM	542	616	3e-24	PFAM
TyrKc	619	878	6.45e-141	SMART
SAM	908	975	1.22e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085169
AA Change: C522R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: C522R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
EPH_lbd	19	196	1.69e-129	SMART
FN3	323	416	2.44e-5	SMART
FN3	434	515	2.26e-9	SMART
transmembrane domain	541	563	N/A	INTRINSIC
TyrKc	585	837	2.35e-134	SMART
SAM	867	934	1.22e-21	SMART

Meta Mutation Damage Score

0.1113

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Apba1	T	C	19: 23,937,506	I690T	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Shank2	C	T	7: 144,409,576	P307L	probably damaging	Het
Slc19a3	G	A	1: 83,014,813	R396C	possibly damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Ephb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Ephb1	APN	9	101996787	missense	probably damaging	1.00
IGL01910:Ephb1	APN	9	102001857	missense	probably benign	0.00
IGL02006:Ephb1	APN	9	102194772	critical splice donor site	probably null
IGL02660:Ephb1	APN	9	102041092	missense	possibly damaging	0.94
IGL02685:Ephb1	APN	9	102041103	nonsense	probably null
IGL02802:Ephb1	UTSW	9	102010019	missense	possibly damaging	0.87
R0098:Ephb1	UTSW	9	102041140	missense	probably damaging	0.98
R0098:Ephb1	UTSW	9	102041140	missense	probably damaging	0.98
R0180:Ephb1	UTSW	9	101927504	missense	probably damaging	0.99
R0488:Ephb1	UTSW	9	101964008	missense	probably damaging	1.00
R0511:Ephb1	UTSW	9	101995980	splice site	probably benign
R0601:Ephb1	UTSW	9	102195130	missense	probably damaging	1.00
R1622:Ephb1	UTSW	9	102001711	missense	probably benign	0.00
R1643:Ephb1	UTSW	9	101996825	missense	probably damaging	0.99
R1645:Ephb1	UTSW	9	101927559	missense	probably damaging	1.00
R1914:Ephb1	UTSW	9	101929378	missense	probably damaging	1.00
R1964:Ephb1	UTSW	9	101971123	missense	possibly damaging	0.93
R2245:Ephb1	UTSW	9	101996774	splice site	probably benign
R2247:Ephb1	UTSW	9	101996811	missense	probably damaging	0.98
R2412:Ephb1	UTSW	9	102001816	missense	possibly damaging	0.85
R3716:Ephb1	UTSW	9	102194800	missense	probably damaging	1.00
R3756:Ephb1	UTSW	9	102041039	missense	probably benign	0.01
R3797:Ephb1	UTSW	9	101971267	missense	probably damaging	1.00
R4981:Ephb1	UTSW	9	102040960	missense	probably benign
R5112:Ephb1	UTSW	9	101971179	missense	probably damaging	1.00
R5507:Ephb1	UTSW	9	101936116	missense	probably damaging	1.00
R5745:Ephb1	UTSW	9	102195434	missense	probably benign	0.25
R6082:Ephb1	UTSW	9	101971104	missense	probably damaging	1.00
R6183:Ephb1	UTSW	9	102195325	missense	probably damaging	1.00
R6228:Ephb1	UTSW	9	101923584	missense	probably damaging	1.00
R6572:Ephb1	UTSW	9	102066898	missense	probably benign
R6596:Ephb1	UTSW	9	102194802	nonsense	probably null
R6813:Ephb1	UTSW	9	102010048	missense	possibly damaging	0.87
R6876:Ephb1	UTSW	9	101984120	missense	probably damaging	1.00
R6922:Ephb1	UTSW	9	101929264	splice site	probably null
R6950:Ephb1	UTSW	9	102194909	missense	probably benign	0.03
R7144:Ephb1	UTSW	9	101964077	missense	probably damaging	1.00
R7146:Ephb1	UTSW	9	101963958	missense	probably damaging	1.00
R7328:Ephb1	UTSW	9	102195239	missense	probably damaging	1.00
R7644:Ephb1	UTSW	9	101936194	missense	probably damaging	1.00
R7737:Ephb1	UTSW	9	101984103	missense	probably damaging	1.00
R8109:Ephb1	UTSW	9	102041023	missense	probably damaging	1.00
R8161:Ephb1	UTSW	9	102194813	missense	probably damaging	1.00
R8486:Ephb1	UTSW	9	101963965	missense	probably benign	0.00
R8958:Ephb1	UTSW	9	102195415	missense	probably damaging	1.00
R9502:Ephb1	UTSW	9	102041287	missense	probably damaging	1.00
R9627:Ephb1	UTSW	9	102041269	missense	possibly damaging	0.94
R9715:Ephb1	UTSW	9	101971185	missense	probably damaging	1.00
X0064:Ephb1	UTSW	9	101971272	missense	probably damaging	1.00
Z1088:Ephb1	UTSW	9	101984145	missense	probably damaging	0.99
Z1176:Ephb1	UTSW	9	102223398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCTGAAGGAATACCACTAGTCTAG -3'
(R):5'- AGAGCTGCCTGGAGTTACAG -3'

Sequencing Primer
(F):5'- ACTAGTCTAGTGAGCCCTGG -3'
(R):5'- CTGGAGTTACAGGGCTCGG -3'

Posted On

2015-04-17