Incidental Mutation 'R0382:Olfr1354'
ID31026
Institutional Source Beutler Lab
Gene Symbol Olfr1354
Ensembl Gene ENSMUSG00000094673
Gene Nameolfactory receptor 1354
SynonymsGA_x6K02T2QGN0-2895081-2894349, EG257869, MOR139-5, MOR185-8, MOR139-7, GA_x6K02T03FR9-4826-3919, Olfr233-ps1
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78913171-78920399 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78917126 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 95 (Y95*)
Ref Sequence ENSEMBL: ENSMUSP00000150374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075859] [ENSMUST00000204587] [ENSMUST00000217073]
Predicted Effect probably null
Transcript: ENSMUST00000075859
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000093126
Gene: ENSMUSG00000094673
AA Change: Y95*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203132
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000144897
Gene: ENSMUSG00000094673
AA Change: Y95*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204587
AA Change: Y95*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205040
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000144994
Gene: ENSMUSG00000094673
AA Change: Y95*

DomainStartEndE-ValueType
Pfam:7tm_4 32 146 9.6e-24 PFAM
Pfam:7TM_GPCR_Srsx 36 147 1.8e-6 PFAM
Pfam:7tm_1 42 147 4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217073
AA Change: Y95*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Olfr1354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Olfr1354 APN 10 78917416 missense probably damaging 0.99
IGL02962:Olfr1354 APN 10 78916939 missense probably damaging 1.00
IGL03032:Olfr1354 APN 10 78917637 missense probably benign 0.21
PIT4495001:Olfr1354 UTSW 10 78916987 missense probably benign
R0268:Olfr1354 UTSW 10 78917605 missense probably damaging 0.99
R0359:Olfr1354 UTSW 10 78917343 missense probably benign 0.00
R1895:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R1946:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R2035:Olfr1354 UTSW 10 78917587 missense possibly damaging 0.86
R3853:Olfr1354 UTSW 10 78916947 missense probably damaging 1.00
R4756:Olfr1354 UTSW 10 78917527 missense probably damaging 0.99
R5326:Olfr1354 UTSW 10 78917586 missense possibly damaging 0.86
R5607:Olfr1354 UTSW 10 78917099 missense possibly damaging 0.93
R7070:Olfr1354 UTSW 10 78917268 missense probably benign
R7088:Olfr1354 UTSW 10 78917759 missense probably benign 0.00
R7212:Olfr1354 UTSW 10 78917505 missense possibly damaging 0.81
R7348:Olfr1354 UTSW 10 78917562 missense probably damaging 1.00
R7386:Olfr1354 UTSW 10 78916843 start codon destroyed probably null 0.98
R7847:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGATGGAATCAGGCAACAGCAC -3'
(R):5'- GCATGTAGGATGCTAACAACCCAGG -3'

Sequencing Primer
(F):5'- TCCATGTACCTGGTAACAGTG -3'
(R):5'- GACAGCAGAACCATCAGTATACAG -3'
Posted On2013-04-24