Incidental Mutation 'R3907:Aspg'
List |< first << previous [record 9 of 62] next >> last >|
ID310269
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Nameasparaginase
Synonyms
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112106679-112127559 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 112112259 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 57 (Y57*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
Predicted Effect probably null
Transcript: ENSMUST00000079400
AA Change: Y50*
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: Y50*

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199383
Predicted Effect probably null
Transcript: ENSMUST00000220719
AA Change: Y43*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221091
Predicted Effect probably benign
Transcript: ENSMUST00000223184
Predicted Effect probably null
Transcript: ENSMUST00000223412
AA Change: Y57*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223457
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112122953 missense probably benign
IGL02199:Aspg APN 12 112120992 missense probably benign 0.39
R0704:Aspg UTSW 12 112114472 missense probably damaging 1.00
R0730:Aspg UTSW 12 112112259 nonsense probably null
R1196:Aspg UTSW 12 112116524 missense possibly damaging 0.94
R1270:Aspg UTSW 12 112116447 missense probably damaging 1.00
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1592:Aspg UTSW 12 112119972 missense probably benign 0.17
R1826:Aspg UTSW 12 112123418 missense probably damaging 0.99
R1859:Aspg UTSW 12 112121172 missense possibly damaging 0.86
R2124:Aspg UTSW 12 112121174 missense probably benign 0.15
R2154:Aspg UTSW 12 112120974 missense probably benign 0.01
R2190:Aspg UTSW 12 112124888 missense probably damaging 0.96
R2221:Aspg UTSW 12 112114434 missense probably damaging 1.00
R2223:Aspg UTSW 12 112114434 missense probably damaging 1.00
R4234:Aspg UTSW 12 112123316 nonsense probably null
R4258:Aspg UTSW 12 112121253 missense probably benign 0.00
R4270:Aspg UTSW 12 112121195 missense probably damaging 1.00
R4271:Aspg UTSW 12 112121195 missense probably damaging 1.00
R5386:Aspg UTSW 12 112123032 missense probably benign 0.01
R5431:Aspg UTSW 12 112123412 missense probably benign 0.13
R5458:Aspg UTSW 12 112120002 missense probably damaging 0.99
R5941:Aspg UTSW 12 112113085 missense probably benign 0.02
R6003:Aspg UTSW 12 112113042 missense probably damaging 1.00
R6057:Aspg UTSW 12 112120998 missense probably damaging 0.96
R6928:Aspg UTSW 12 112126689 missense possibly damaging 0.52
R6979:Aspg UTSW 12 112120944 missense possibly damaging 0.77
R6998:Aspg UTSW 12 112112194 missense probably damaging 1.00
R7054:Aspg UTSW 12 112126390 missense probably damaging 0.98
R7060:Aspg UTSW 12 112122953 missense probably benign
R7124:Aspg UTSW 12 112122983 missense probably damaging 0.99
R7137:Aspg UTSW 12 112112198 missense possibly damaging 0.92
R7439:Aspg UTSW 12 112124821 missense possibly damaging 0.90
R7441:Aspg UTSW 12 112124821 missense possibly damaging 0.90
Z1176:Aspg UTSW 12 112113081 missense possibly damaging 0.58
Z1177:Aspg UTSW 12 112121021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGTCTTGTCTGGTCCAGC -3'
(R):5'- CTCAAGGTTTCAGATGTGCCTC -3'

Sequencing Primer
(F):5'- ATGGGTGTTTGACTGCAAG -3'
(R):5'- TCATGCAAATGGCTCACATGG -3'
Posted On2015-04-17