Mutagenetix > Incidental Mutation

Incidental Mutation 'R3907:Apba1'

310281

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

040908-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23937506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 690 (I690T)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

AlphaFold

B2RUJ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000025830
AA Change: I690T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: I690T

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Meta Mutation Damage Score

0.8309

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Ephb1	A	G	9: 102,001,726	C522R	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Shank2	C	T	7: 144,409,576	P307L	probably damaging	Het
Slc19a3	G	A	1: 83,014,813	R396C	possibly damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0379:Apba1	UTSW	19	23934830	missense	probably damaging	1.00
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1714:Apba1	UTSW	19	23944952	missense	possibly damaging	0.67
R1756:Apba1	UTSW	19	23893692	missense	possibly damaging	0.83
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R2217:Apba1	UTSW	19	23893962	missense	probably damaging	0.99
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R4972:Apba1	UTSW	19	23912536	missense	probably benign	0.24
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
R9149:Apba1	UTSW	19	23893418	missense	probably damaging	1.00
R9288:Apba1	UTSW	19	23945781	makesense	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCCAAAGAAGTGTCTC -3'
(R):5'- CACAAATTTTGAGGACTGGGTGG -3'

Sequencing Primer
(F):5'- GCTGCTGATTCGAGATTTC -3'
(R):5'- GTGGCAGTCACACTTCACATCATG -3'

Posted On

2015-04-17