Incidental Mutation 'R3908:Mpp4'
ID310284
Institutional Source Beutler Lab
Gene Symbol Mpp4
Ensembl Gene ENSMUSG00000079550
Gene Namemembrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
SynonymsDLG6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59120935-59163389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59149037 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 183 (H183L)
Ref Sequence ENSEMBL: ENSMUSP00000140957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000114275] [ENSMUST00000186477] [ENSMUST00000191200]
Predicted Effect probably damaging
Transcript: ENSMUST00000066374
AA Change: H183L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550
AA Change: H183L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078874
AA Change: H183L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550
AA Change: H183L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114275
AA Change: H202L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550
AA Change: H202L

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186477
AA Change: H183L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550
AA Change: H183L

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190598
Predicted Effect probably damaging
Transcript: ENSMUST00000191200
AA Change: H183L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550
AA Change: H183L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutations display sporadic photorecptor displacement. Correct protein localization at the presynaptic photoreceptor membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Mpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mpp4 APN 1 59149519 critical splice donor site probably null
IGL01346:Mpp4 APN 1 59125560 missense probably damaging 1.00
IGL01680:Mpp4 APN 1 59130067 missense probably benign 0.21
IGL02123:Mpp4 APN 1 59161466 splice site probably null
IGL02299:Mpp4 APN 1 59158579 splice site probably benign
IGL02793:Mpp4 APN 1 59136834 splice site probably null
IGL02875:Mpp4 APN 1 59136834 splice site probably null
E0370:Mpp4 UTSW 1 59139758 splice site probably benign
R0391:Mpp4 UTSW 1 59143829 splice site probably benign
R0517:Mpp4 UTSW 1 59124727 nonsense probably null
R0725:Mpp4 UTSW 1 59121422 missense probably damaging 1.00
R0968:Mpp4 UTSW 1 59130090 missense probably damaging 1.00
R1753:Mpp4 UTSW 1 59144810 missense probably null 1.00
R1956:Mpp4 UTSW 1 59158652 missense probably benign 0.01
R1968:Mpp4 UTSW 1 59144802 missense probably damaging 1.00
R2062:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2064:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2065:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2068:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2088:Mpp4 UTSW 1 59123465 missense possibly damaging 0.68
R2108:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2426:Mpp4 UTSW 1 59130057 missense probably damaging 0.99
R2897:Mpp4 UTSW 1 59144694 missense probably benign
R2898:Mpp4 UTSW 1 59144694 missense probably benign
R3938:Mpp4 UTSW 1 59124683 missense possibly damaging 0.94
R4050:Mpp4 UTSW 1 59146744 splice site probably null
R4396:Mpp4 UTSW 1 59144802 missense possibly damaging 0.56
R4908:Mpp4 UTSW 1 59125589 missense probably damaging 1.00
R5169:Mpp4 UTSW 1 59130097 critical splice acceptor site probably null
R5185:Mpp4 UTSW 1 59125583 missense probably benign 0.10
R5249:Mpp4 UTSW 1 59144858 splice site probably benign
R5333:Mpp4 UTSW 1 59157441 missense probably benign 0.03
R5563:Mpp4 UTSW 1 59124629 critical splice donor site probably null
R5779:Mpp4 UTSW 1 59151666 missense probably benign 0.09
R5829:Mpp4 UTSW 1 59128942 missense probably damaging 0.99
R5934:Mpp4 UTSW 1 59121376 missense probably damaging 1.00
R6017:Mpp4 UTSW 1 59121359 missense probably damaging 1.00
R6845:Mpp4 UTSW 1 59144804 missense probably benign 0.05
R7013:Mpp4 UTSW 1 59149615 missense probably damaging 1.00
R7292:Mpp4 UTSW 1 59143810 missense possibly damaging 0.51
R7775:Mpp4 UTSW 1 59123513 missense not run
R7778:Mpp4 UTSW 1 59123513 missense not run
R7912:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
R8354:Mpp4 UTSW 1 59130065 missense probably damaging 1.00
R8524:Mpp4 UTSW 1 59144681 missense probably damaging 1.00
R8894:Mpp4 UTSW 1 59158584 critical splice donor site probably null
X0013:Mpp4 UTSW 1 59123453 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGCATCCCTTGAAACAACTTTTC -3'
(R):5'- GATGCAAAGGCTTCTATTGAGTG -3'

Sequencing Primer
(F):5'- AACAACTTTTCTTGTTTCTTTACTGC -3'
(R):5'- CAAAGGCTTCTATTGAGTGTCTTTC -3'
Posted On2015-04-17