Incidental Mutation 'R3908:Ppp1r12b'
ID310285
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134842732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 617 (S617P)
Ref Sequence ENSEMBL: ENSMUSP00000131406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000168381]
Predicted Effect probably damaging
Transcript: ENSMUST00000045665
AA Change: S617P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557
AA Change: S617P

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086444
AA Change: S617P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557
AA Change: S617P

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156348
Predicted Effect probably damaging
Transcript: ENSMUST00000168381
AA Change: S617P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557
AA Change: S617P

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188123
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0556:Ppp1r12b UTSW 1 134777322 missense probably damaging 1.00
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1839:Ppp1r12b UTSW 1 134837981 missense probably benign 0.32
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5771:Ppp1r12b UTSW 1 134773424 critical splice donor site probably null
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R6868:Ppp1r12b UTSW 1 134886438 missense probably benign 0.00
R7681:Ppp1r12b UTSW 1 134865935 missense probably benign 0.02
R7940:Ppp1r12b UTSW 1 134876055 missense probably benign 0.00
R8057:Ppp1r12b UTSW 1 134955616 missense probably damaging 1.00
R8070:Ppp1r12b UTSW 1 134876069 missense probably benign 0.06
R8134:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R8147:Ppp1r12b UTSW 1 134873942 missense possibly damaging 0.78
R8224:Ppp1r12b UTSW 1 134902462 missense probably benign 0.19
R8270:Ppp1r12b UTSW 1 134876148 missense probably benign 0.37
R8304:Ppp1r12b UTSW 1 134896363 missense possibly damaging 0.65
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCTACACACTTCCACTGG -3'
(R):5'- TAGCCAGTAAGTCCCCTGTAGC -3'

Sequencing Primer
(F):5'- TCCACTGGGGAGGAGAAAG -3'
(R):5'- CAGGTCCCTGTCACAAAGGTAG -3'
Posted On2015-04-17