Incidental Mutation 'R3908:Mum1'
ID310294
Institutional Source Beutler Lab
Gene Symbol Mum1
Ensembl Gene ENSMUSG00000020156
Gene Namemelanoma associated antigen (mutated) 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80226434-80243903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80238316 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 401 (V401A)
Ref Sequence ENSEMBL: ENSMUSP00000020365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020365]
Predicted Effect probably damaging
Transcript: ENSMUST00000020365
AA Change: V401A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020365
Gene: ENSMUSG00000020156
AA Change: V401A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Pfam:PWWP 381 458 2.9e-8 PFAM
low complexity region 671 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146538
Meta Mutation Damage Score 0.6670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Mum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mum1 APN 10 80234329 critical splice donor site probably null
IGL02152:Mum1 APN 10 80239978 missense probably damaging 1.00
IGL02541:Mum1 APN 10 80228439 critical splice donor site probably null
IGL02562:Mum1 APN 10 80238895 missense probably damaging 1.00
IGL02609:Mum1 APN 10 80230083 missense probably damaging 0.99
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0378:Mum1 UTSW 10 80238879 splice site probably null
R0441:Mum1 UTSW 10 80229025 missense probably damaging 1.00
R0675:Mum1 UTSW 10 80230080 missense probably damaging 0.99
R1558:Mum1 UTSW 10 80232944 missense probably benign 0.05
R1612:Mum1 UTSW 10 80233055 unclassified probably benign
R1873:Mum1 UTSW 10 80232608 missense possibly damaging 0.93
R2247:Mum1 UTSW 10 80240425 missense probably damaging 1.00
R3905:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3907:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R4468:Mum1 UTSW 10 80240736 intron probably benign
R4657:Mum1 UTSW 10 80233014 missense probably benign 0.00
R4989:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5030:Mum1 UTSW 10 80240375 intron probably benign
R5133:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5134:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5239:Mum1 UTSW 10 80228421 nonsense probably null
R6119:Mum1 UTSW 10 80229031 missense probably benign 0.25
R6253:Mum1 UTSW 10 80233014 missense probably benign 0.00
R6526:Mum1 UTSW 10 80232279 missense probably benign 0.18
R7421:Mum1 UTSW 10 80232753 missense probably benign 0.38
R8116:Mum1 UTSW 10 80240397 missense probably damaging 1.00
R8252:Mum1 UTSW 10 80241860 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGGAGACTTGTGGATTCTACC -3'
(R):5'- GCTGAAACTCTGCTCTGGTG -3'

Sequencing Primer
(F):5'- GATTCTACCTTGTAATACCACAGAGC -3'
(R):5'- TCTGGCTGAAACACCAAGTG -3'
Posted On2015-04-17