Incidental Mutation 'R3908:Il22'
ID 310295
Institutional Source Beutler Lab
Gene Symbol Il22
Ensembl Gene ENSMUSG00000074695
Gene Name interleukin 22
Synonyms IL-22, Iltif, IL-TIF
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R3908 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 118040847-118045952 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 118041529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 81 (R81*)
Ref Sequence ENSEMBL: ENSMUSP00000094449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096691]
AlphaFold Q9JJY9
Predicted Effect probably null
Transcript: ENSMUST00000096691
AA Change: R81*
SMART Domains Protein: ENSMUSP00000094449
Gene: ENSMUSG00000074695
AA Change: R81*

DomainStartEndE-ValueType
IL10 49 179 7.88e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this locus results in abnormalities in Il23-induced dermal inflammation and acanthosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 (GRCm39) V1352A possibly damaging Het
Abcb7 G T X: 103,327,765 (GRCm39) Q715K probably benign Het
Adamts3 C A 5: 90,009,214 (GRCm39) G150C probably damaging Het
Cacng1 C A 11: 107,607,118 (GRCm39) V34L probably benign Het
Ddi2 T C 4: 141,411,592 (GRCm39) D440G probably benign Het
Esp34 A G 17: 38,870,532 (GRCm39) D74G possibly damaging Het
Fanci T C 7: 79,083,257 (GRCm39) V748A possibly damaging Het
Fat1 G C 8: 45,476,072 (GRCm39) R1706T probably benign Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Jak2 T A 19: 29,268,673 (GRCm39) L583Q probably damaging Het
Kcnj4 G T 15: 79,369,946 (GRCm39) H11Q probably benign Het
Kif11 A G 19: 37,379,169 (GRCm39) I287V probably damaging Het
Lasp1 G A 11: 97,690,653 (GRCm39) V12M probably damaging Het
Matr3 C T 18: 35,705,894 (GRCm39) P273L probably damaging Het
Mpp4 T A 1: 59,188,196 (GRCm39) H183L probably damaging Het
Myh10 T C 11: 68,661,885 (GRCm39) probably null Het
Or52h7 T C 7: 104,213,848 (GRCm39) I140T probably benign Het
Ppp1r12b A G 1: 134,770,470 (GRCm39) S617P probably damaging Het
Psmb1 T C 17: 15,710,543 (GRCm39) Y2C probably damaging Het
Pwwp3a T C 10: 80,074,150 (GRCm39) V401A probably damaging Het
Serpinb9f A G 13: 33,511,919 (GRCm39) T141A probably damaging Het
Slc38a4 T C 15: 96,910,875 (GRCm39) probably null Het
Vmn2r9 C A 5: 108,995,785 (GRCm39) A288S probably benign Het
Zbtb12 A T 17: 35,115,244 (GRCm39) probably null Het
Other mutations in Il22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03204:Il22 APN 10 118,041,085 (GRCm39) splice site probably benign
IGL03290:Il22 APN 10 118,041,785 (GRCm39) critical splice donor site probably null
PIT4651001:Il22 UTSW 10 118,041,495 (GRCm39) missense probably damaging 1.00
R0184:Il22 UTSW 10 118,041,511 (GRCm39) missense probably damaging 1.00
R3905:Il22 UTSW 10 118,041,529 (GRCm39) nonsense probably null
R4703:Il22 UTSW 10 118,041,511 (GRCm39) missense probably damaging 1.00
R4797:Il22 UTSW 10 118,041,058 (GRCm39) missense probably damaging 0.98
R4799:Il22 UTSW 10 118,041,058 (GRCm39) missense probably damaging 0.98
R5439:Il22 UTSW 10 118,045,366 (GRCm39) nonsense probably null
R5496:Il22 UTSW 10 118,041,002 (GRCm39) missense possibly damaging 0.73
R5957:Il22 UTSW 10 118,041,071 (GRCm39) missense probably damaging 1.00
R6584:Il22 UTSW 10 118,040,932 (GRCm39) missense probably benign 0.00
R6862:Il22 UTSW 10 118,041,715 (GRCm39) missense probably benign 0.41
R7381:Il22 UTSW 10 118,041,069 (GRCm39) missense possibly damaging 0.48
R8095:Il22 UTSW 10 118,041,028 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGAGGCGCATTTAGAAAGCC -3'
(R):5'- CAGAACGTCTTCCAGGGTGAAG -3'

Sequencing Primer
(F):5'- TTTAGAAAGCCACCCACGACTG -3'
(R):5'- CTTCCAGGGTGAAGTTGAGCAC -3'
Posted On 2015-04-17