Incidental Mutation 'R3908:Cacng1'
ID310298
Institutional Source Beutler Lab
Gene Symbol Cacng1
Ensembl Gene ENSMUSG00000020722
Gene Namecalcium channel, voltage-dependent, gamma subunit 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107703218-107716522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107716292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 34 (V34L)
Ref Sequence ENSEMBL: ENSMUSP00000021065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021065]
Predicted Effect probably benign
Transcript: ENSMUST00000021065
AA Change: V34L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021065
Gene: ENSMUSG00000020722
AA Change: V34L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 200 6.3e-12 PFAM
Pfam:Claudin_2 17 202 2.6e-41 PFAM
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for null mutations display abnormal muscle calcium currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Cacng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Cacng1 APN 11 107704369 missense probably benign
IGL02623:Cacng1 APN 11 107704319 missense probably damaging 1.00
R0920:Cacng1 UTSW 11 107705856 splice site probably benign
R2042:Cacng1 UTSW 11 107704308 missense probably damaging 1.00
R3906:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3909:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R5247:Cacng1 UTSW 11 107716279 missense probably benign 0.45
R7158:Cacng1 UTSW 11 107703839 missense probably damaging 0.99
R7473:Cacng1 UTSW 11 107716192 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGCCAACAAACTCTGCTC -3'
(R):5'- CACTGCCACCATCTAGCTAG -3'

Sequencing Primer
(F):5'- CTTATCTTGGAGTCTTGAAAGGAC -3'
(R):5'- ATCTAGCTAGCTGCCTGGGAG -3'
Posted On2015-04-17