Incidental Mutation 'R0382:Natd1'
ID31030
Institutional Source Beutler Lab
Gene Symbol Natd1
Ensembl Gene ENSMUSG00000018931
Gene NameN-acetyltransferase domain containing 1
SynonymsF3-2, Gm16515, Gtlf3b
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60902246-60914750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60906913 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 62 (R62H)
Ref Sequence ENSEMBL: ENSMUSP00000019075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019075]
Predicted Effect probably damaging
Transcript: ENSMUST00000019075
AA Change: R62H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019075
Gene: ENSMUSG00000018931
AA Change: R62H

DomainStartEndE-ValueType
Pfam:Acetyltransf_CG 26 106 6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143800
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Natd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4787:Natd1 UTSW 11 60906996 missense probably damaging 1.00
R5180:Natd1 UTSW 11 60913656 missense probably benign 0.01
R5654:Natd1 UTSW 11 60906066 missense probably damaging 1.00
R7697:Natd1 UTSW 11 60906982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACCAGGGCTAACTAAGCAAG -3'
(R):5'- TGCCAGGAATAACGAAGCTCCG -3'

Sequencing Primer
(F):5'- GGCTAACTAAGCAAGTACTGC -3'
(R):5'- AGCTCCGAGGGCCTCTG -3'
Posted On2013-04-24