Incidental Mutation 'R3908:Psmb1'
ID310303
Institutional Source Beutler Lab
Gene Symbol Psmb1
Ensembl Gene ENSMUSG00000014769
Gene Nameproteasome (prosome, macropain) subunit, beta type 1
SynonymsLmpc5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location15475021-15499751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15490281 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2 (Y2C)
Ref Sequence ENSEMBL: ENSMUSP00000156359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014913] [ENSMUST00000231341] [ENSMUST00000232500]
Predicted Effect probably damaging
Transcript: ENSMUST00000014913
AA Change: Y102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014913
Gene: ENSMUSG00000014769
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Proteasome 33 225 8.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231341
AA Change: Y102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232500
AA Change: Y2C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Psmb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Psmb1 APN 17 15490284 start codon destroyed probably null 0.21
R0416:Psmb1 UTSW 17 15494519 missense probably benign 0.00
R4946:Psmb1 UTSW 17 15498216 missense probably benign 0.01
R4976:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R4979:Psmb1 UTSW 17 15476189 missense probably benign 0.23
R5119:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R5506:Psmb1 UTSW 17 15490216 missense probably damaging 1.00
R5939:Psmb1 UTSW 17 15498178 missense probably damaging 1.00
R6848:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7178:Psmb1 UTSW 17 15477259 missense possibly damaging 0.50
R7701:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7891:Psmb1 UTSW 17 15494486 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATAGCACAACTCCAGGCAG -3'
(R):5'- GTCAGGTTTAGTCACATTCCGAG -3'

Sequencing Primer
(F):5'- GGCAGAAGCACACACATTTATG -3'
(R):5'- TGTGATCTGAAAAACAAGCTACTGAG -3'
Posted On2015-04-17