Incidental Mutation 'R3908:Hspa1a'
ID310305
Institutional Source Beutler Lab
Gene Symbol Hspa1a
Ensembl Gene ENSMUSG00000091971
Gene Nameheat shock protein 1A
SynonymsHsp70.3, Hsp70-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3908 (G1)
Quality Score157
Status Not validated
Chromosome17
Chromosomal Location34969190-34972156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34971727 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 67 (V67M)
Ref Sequence ENSEMBL: ENSMUSP00000084586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000087328] [ENSMUST00000173680]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087328
AA Change: V67M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084586
Gene: ENSMUSG00000091971
AA Change: V67M

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173680
SMART Domains Protein: ENSMUSP00000133726
Gene: ENSMUSG00000092609

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
internal_repeat_1 91 102 5.9e-5 PROSPERO
internal_repeat_1 113 124 5.9e-5 PROSPERO
low complexity region 134 146 N/A INTRINSIC
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: At the cellular level, mice homozygous for a knock-out allele exhibit impaired thermotolerance and increased sensitivity to heat stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Hspa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Hspa1a APN 17 34970524 missense probably damaging 1.00
IGL03380:Hspa1a APN 17 34970277 missense probably benign 0.17
R1983:Hspa1a UTSW 17 34970962 missense probably benign 0.01
R2117:Hspa1a UTSW 17 34970479 missense probably damaging 1.00
R3825:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3905:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3906:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3909:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R4301:Hspa1a UTSW 17 34970506 missense probably benign 0.11
R4453:Hspa1a UTSW 17 34970293 missense probably benign 0.32
R4610:Hspa1a UTSW 17 34971180 missense probably damaging 0.96
R4904:Hspa1a UTSW 17 34970451 missense probably damaging 1.00
R6253:Hspa1a UTSW 17 34970550 missense probably damaging 1.00
R6366:Hspa1a UTSW 17 34970524 missense probably damaging 1.00
R6478:Hspa1a UTSW 17 34970306 missense probably damaging 1.00
R6981:Hspa1a UTSW 17 34970291 splice site probably null
R8015:Hspa1a UTSW 17 34970649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATGGACGAGATCTC -3'
(R):5'- TTCCATCCAGAGACAAGCG -3'

Sequencing Primer
(F):5'- GAGATCTCCTCCGGGAAGAAC -3'
(R):5'- TTCCAGAAGCAGAGCGC -3'
Posted On2015-04-17