Incidental Mutation 'R3908:Esp34'
ID310306
Institutional Source Beutler Lab
Gene Symbol Esp34
Ensembl Gene ENSMUSG00000092244
Gene Nameexocrine gland secreted peptide 34
SynonymsGm20410
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38554192-38560621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38559641 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Ref Sequence ENSEMBL: ENSMUSP00000136619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173055] [ENSMUST00000178654]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173055
AA Change: D142G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133675
Gene: ENSMUSG00000092244
AA Change: D142G

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:ESP 92 147 9.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178654
AA Change: D74G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136619
Gene: ENSMUSG00000092244
AA Change: D74G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 77 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Matr3 C T 18: 35,572,841 P273L probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Esp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1479:Esp34 UTSW 17 38554328 utr 5 prime probably benign
R1854:Esp34 UTSW 17 38559533 missense possibly damaging 0.85
R4013:Esp34 UTSW 17 38559555 nonsense probably null
R4392:Esp34 UTSW 17 38559491 missense possibly damaging 0.51
R6008:Esp34 UTSW 17 38554227 utr 5 prime probably benign
R7522:Esp34 UTSW 17 38559541 missense possibly damaging 0.71
R7532:Esp34 UTSW 17 38559620 missense possibly damaging 0.93
R7554:Esp34 UTSW 17 38555891 missense probably benign 0.02
R7686:Esp34 UTSW 17 38559643 missense possibly damaging 0.71
R8008:Esp34 UTSW 17 38559599 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATTAGTCTTGATCTCGCAGTCTCTG -3'
(R):5'- ACAGTATTTAGAACACTAGGAGCC -3'

Sequencing Primer
(F):5'- GATCTCGCAGTCTCTGTTCATCCTG -3'
(R):5'- ACACTAGGAGCCAATATTTTATTTGG -3'
Posted On2015-04-17