Incidental Mutation 'R3908:Matr3'
ID310307
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Namematrin 3
Synonyms2810017I02Rik, D030046F20Rik, 1110061A14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3908 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35562146-35593835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35572841 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 273 (P273L)
Ref Sequence ENSEMBL: ENSMUSP00000141189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186292] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187513] [ENSMUST00000187543] [ENSMUST00000187793] [ENSMUST00000188275] [ENSMUST00000188359] [ENSMUST00000188767] [ENSMUST00000189039] [ENSMUST00000189163] [ENSMUST00000190029] [ENSMUST00000190653] [ENSMUST00000190458] [ENSMUST00000190121]
Predicted Effect probably damaging
Transcript: ENSMUST00000166793
AA Change: P273L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: P273L

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186292
SMART Domains Protein: ENSMUSP00000139437
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186295
Predicted Effect probably damaging
Transcript: ENSMUST00000186614
AA Change: P273L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236
AA Change: P273L

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186796
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187389
AA Change: P273L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: P273L

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187513
SMART Domains Protein: ENSMUSP00000139875
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187543
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187980
Predicted Effect probably benign
Transcript: ENSMUST00000188275
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188359
SMART Domains Protein: ENSMUSP00000140148
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189039
AA Change: P21L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236
AA Change: P21L

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect probably damaging
Transcript: ENSMUST00000190029
AA Change: P273L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: P273L

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193225
Predicted Effect probably benign
Transcript: ENSMUST00000190653
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190458
SMART Domains Protein: ENSMUSP00000139922
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190121
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Esp34 A G 17: 38,559,641 D74G possibly damaging Het
Fanci T C 7: 79,433,509 V748A possibly damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Jak2 T A 19: 29,291,273 L583Q probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif11 A G 19: 37,390,721 I287V probably damaging Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Mpp4 T A 1: 59,149,037 H183L probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myh10 T C 11: 68,771,059 probably null Het
Olfr652 T C 7: 104,564,641 I140T probably benign Het
Ppp1r12b A G 1: 134,842,732 S617P probably damaging Het
Psmb1 T C 17: 15,490,281 Y2C probably damaging Het
Serpinb9f A G 13: 33,327,936 T141A probably damaging Het
Slc38a4 T C 15: 97,012,994 probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Zbtb12 A T 17: 34,896,268 probably null Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35588389 missense probably damaging 1.00
IGL03083:Matr3 APN 18 35572418 missense probably damaging 0.96
IGL03117:Matr3 APN 18 35572657 missense probably damaging 1.00
IGL03163:Matr3 APN 18 35572591 missense probably damaging 0.99
IGL03381:Matr3 APN 18 35579025 splice site probably benign
R0456:Matr3 UTSW 18 35572864 missense probably damaging 1.00
R1136:Matr3 UTSW 18 35572895 missense probably damaging 1.00
R1459:Matr3 UTSW 18 35584656 missense probably benign 0.28
R1850:Matr3 UTSW 18 35582057 missense probably damaging 1.00
R1929:Matr3 UTSW 18 35588325 splice site probably benign
R2185:Matr3 UTSW 18 35581225 missense probably damaging 1.00
R2366:Matr3 UTSW 18 35588395 missense probably damaging 1.00
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2873:Matr3 UTSW 18 35572296 missense probably benign 0.25
R4400:Matr3 UTSW 18 35583916 missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35572118 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4881:Matr3 UTSW 18 35572375 missense probably damaging 1.00
R4908:Matr3 UTSW 18 35572701 missense probably damaging 0.96
R5084:Matr3 UTSW 18 35582082 missense probably damaging 0.99
R5660:Matr3 UTSW 18 35572094 missense probably damaging 0.99
R5709:Matr3 UTSW 18 35581962 missense probably damaging 1.00
R5779:Matr3 UTSW 18 35584522 missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35587738 missense probably benign
R6392:Matr3 UTSW 18 35584841 missense probably benign 0.07
R7062:Matr3 UTSW 18 35579019 critical splice donor site probably null
R7156:Matr3 UTSW 18 35572921 missense probably damaging 0.98
R7228:Matr3 UTSW 18 35562484 missense unknown
R7389:Matr3 UTSW 18 35584585 missense probably benign
R8940:Matr3 UTSW 18 35572587 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGAAGTCGTTCTCAAGAATCTGG -3'
(R):5'- TCAACTCAATGTCATCAGACTACAG -3'

Sequencing Primer
(F):5'- TCGTTCTCAAGAATCTGGTTATTATG -3'
(R):5'- GAAGCATCTGTTGCTTTAACT -3'
Posted On2015-04-17