Incidental Mutation 'R3890:Rprd2'
ID310326
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Nameregulation of nuclear pre-mRNA domain containing 2
Synonyms6720469I21Rik, 2810036A19Rik, 4930535B03Rik
MMRRC Submission 040802-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R3890 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95760341-95818863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95765224 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 956 (F956I)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
Predicted Effect probably damaging
Transcript: ENSMUST00000090791
AA Change: F956I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: F956I

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200164
AA Change: F872I
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,554,700 Y201C probably damaging Het
Adam10 A G 9: 70,768,854 T624A probably benign Het
Atf2 T C 2: 73,863,213 S2G probably damaging Het
Atf7ip T C 6: 136,587,045 V762A possibly damaging Het
Cacna1e C T 1: 154,483,553 R265Q probably damaging Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Cntrl T G 2: 35,170,480 C1342G probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Dennd4a T C 9: 64,872,028 S598P probably damaging Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ect2 T C 3: 27,138,540 D387G probably damaging Het
Fam208b T C 13: 3,596,785 E80G probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fmo4 A T 1: 162,794,055 I529N probably benign Het
Frs3 A G 17: 47,703,435 D351G probably damaging Het
Gcat T A 15: 79,037,176 V378D probably damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Hspa4l A T 3: 40,781,594 Q570L possibly damaging Het
Ifi213 A G 1: 173,567,256 I571T probably benign Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mettl1 T C 10: 127,045,129 probably null Het
Mettl15 A G 2: 109,191,579 I127T probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Mobp G A 9: 120,167,956 C51Y probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myrip A G 9: 120,422,258 E210G probably damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pdgfra A G 5: 75,167,927 N240S probably null Het
Pdxdc1 T C 16: 13,836,448 T759A probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Prdm15 T C 16: 97,799,571 H829R probably damaging Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Samd1 G A 8: 83,997,732 probably benign Het
Slc4a11 A T 2: 130,685,785 S592T probably damaging Het
Slc5a4b A G 10: 76,062,260 V540A probably benign Het
Slfn8 G A 11: 83,004,444 T512I possibly damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Sorl1 G A 9: 42,004,105 T1276M probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Speer4f1 T C 5: 17,479,502 I176T probably damaging Het
Spint1 T C 2: 119,248,802 I455T probably benign Het
Srp54a A G 12: 55,089,193 probably null Het
Stoml3 T A 3: 53,507,454 N222K probably damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tanc2 A T 11: 105,798,678 D222V probably damaging Het
Thsd7a G A 6: 12,418,337 S631L probably benign Het
Vmn2r73 G A 7: 85,857,936 H723Y probably benign Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95764089 missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95766087 missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95765775 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95776793 missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95764055 missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95780584 missense probably damaging 0.99
RF034:Rprd2 UTSW 3 95766320 small deletion probably benign
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CGTCGATGTGGTGGAAATCG -3'
(R):5'- CTGTCTAGTTACAACCACAGGG -3'

Sequencing Primer
(F):5'- GGAGGCCAGGACTTTTTCC -3'
(R):5'- ACCACAGGGCCCAAGAGTTTG -3'
Posted On2015-04-17