Incidental Mutation 'R3890:Vmn2r73'
ID310335
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission 040802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3890 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85857936 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 723 (H723Y)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: H723Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: H723Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,554,700 Y201C probably damaging Het
Adam10 A G 9: 70,768,854 T624A probably benign Het
Atf2 T C 2: 73,863,213 S2G probably damaging Het
Atf7ip T C 6: 136,587,045 V762A possibly damaging Het
Cacna1e C T 1: 154,483,553 R265Q probably damaging Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Cntrl T G 2: 35,170,480 C1342G probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Dennd4a T C 9: 64,872,028 S598P probably damaging Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ect2 T C 3: 27,138,540 D387G probably damaging Het
Fam208b T C 13: 3,596,785 E80G probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fmo4 A T 1: 162,794,055 I529N probably benign Het
Frs3 A G 17: 47,703,435 D351G probably damaging Het
Gcat T A 15: 79,037,176 V378D probably damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Hspa4l A T 3: 40,781,594 Q570L possibly damaging Het
Ifi213 A G 1: 173,567,256 I571T probably benign Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mettl1 T C 10: 127,045,129 probably null Het
Mettl15 A G 2: 109,191,579 I127T probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Mobp G A 9: 120,167,956 C51Y probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myrip A G 9: 120,422,258 E210G probably damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pdgfra A G 5: 75,167,927 N240S probably null Het
Pdxdc1 T C 16: 13,836,448 T759A probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Prdm15 T C 16: 97,799,571 H829R probably damaging Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Rprd2 A T 3: 95,765,224 F956I probably damaging Het
Samd1 G A 8: 83,997,732 probably benign Het
Slc4a11 A T 2: 130,685,785 S592T probably damaging Het
Slc5a4b A G 10: 76,062,260 V540A probably benign Het
Slfn8 G A 11: 83,004,444 T512I possibly damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Sorl1 G A 9: 42,004,105 T1276M probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Speer4f1 T C 5: 17,479,502 I176T probably damaging Het
Spint1 T C 2: 119,248,802 I455T probably benign Het
Srp54a A G 12: 55,089,193 probably null Het
Stoml3 T A 3: 53,507,454 N222K probably damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tanc2 A T 11: 105,798,678 D222V probably damaging Het
Thsd7a G A 6: 12,418,337 S631L probably benign Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCATGCTGAATGTCAAG -3'
(R):5'- CCTGCAGCAGAGCACATTTG -3'

Sequencing Primer
(F):5'- CATGCTGAATGTCAAGAGCTTGGC -3'
(R):5'- GCCTCTACTATCTTGGCCAAG -3'
Posted On2015-04-17