Incidental Mutation 'R3890:Deup1'
ID 310343
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Name deuterosome assembly protein 1
Synonyms Ccdc67, 4933401K09Rik
MMRRC Submission 040802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3890 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 15559864-15627933 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15599713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 257 (Y257H)
Ref Sequence ENSEMBL: ENSMUSP00000111256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]
AlphaFold Q7M6Y5
Predicted Effect probably damaging
Transcript: ENSMUST00000045513
AA Change: Y257H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: Y257H

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115592
AA Change: Y257H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: Y257H

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115593
AA Change: Y257H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: Y257H

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152377
AA Change: Y257H

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977
AA Change: Y257H

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,554,700 Y201C probably damaging Het
Adam10 A G 9: 70,768,854 T624A probably benign Het
Atf2 T C 2: 73,863,213 S2G probably damaging Het
Atf7ip T C 6: 136,587,045 V762A possibly damaging Het
Cacna1e C T 1: 154,483,553 R265Q probably damaging Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Cntrl T G 2: 35,170,480 C1342G probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Dennd4a T C 9: 64,872,028 S598P probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ect2 T C 3: 27,138,540 D387G probably damaging Het
Fam208b T C 13: 3,596,785 E80G probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fmo4 A T 1: 162,794,055 I529N probably benign Het
Frs3 A G 17: 47,703,435 D351G probably damaging Het
Gcat T A 15: 79,037,176 V378D probably damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Hspa4l A T 3: 40,781,594 Q570L possibly damaging Het
Ifi213 A G 1: 173,567,256 I571T probably benign Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mettl1 T C 10: 127,045,129 probably null Het
Mettl15 A G 2: 109,191,579 I127T probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Mobp G A 9: 120,167,956 C51Y probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myrip A G 9: 120,422,258 E210G probably damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pdgfra A G 5: 75,167,927 N240S probably null Het
Pdxdc1 T C 16: 13,836,448 T759A probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Prdm15 T C 16: 97,799,571 H829R probably damaging Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Rprd2 A T 3: 95,765,224 F956I probably damaging Het
Samd1 G A 8: 83,997,732 probably benign Het
Slc4a11 A T 2: 130,685,785 S592T probably damaging Het
Slc5a4b A G 10: 76,062,260 V540A probably benign Het
Slfn8 G A 11: 83,004,444 T512I possibly damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Sorl1 G A 9: 42,004,105 T1276M probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Speer4f1 T C 5: 17,479,502 I176T probably damaging Het
Spint1 T C 2: 119,248,802 I455T probably benign Het
Srp54a A G 12: 55,089,193 probably null Het
Stoml3 T A 3: 53,507,454 N222K probably damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tanc2 A T 11: 105,798,678 D222V probably damaging Het
Thsd7a G A 6: 12,418,337 S631L probably benign Het
Vmn2r73 G A 7: 85,857,936 H723Y probably benign Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15561370 missense probably damaging 0.96
IGL00927:Deup1 APN 9 15610671 splice site probably benign
IGL00946:Deup1 APN 9 15561238 missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15592360 missense probably benign 0.02
IGL02567:Deup1 APN 9 15575283 missense probably damaging 1.00
IGL03089:Deup1 APN 9 15607800 missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15592411 missense probably benign 0.38
IGL03147:Deup1 UTSW 9 15610614 missense probably damaging 0.99
PIT4468001:Deup1 UTSW 9 15564005 missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0324:Deup1 UTSW 9 15582533 missense probably benign 0.01
R0539:Deup1 UTSW 9 15582597 missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15599751 missense probably damaging 1.00
R1666:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R2212:Deup1 UTSW 9 15599843 missense probably benign 0.00
R2237:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2238:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2423:Deup1 UTSW 9 15592458 nonsense probably null
R2929:Deup1 UTSW 9 15575188 missense probably benign 0.03
R3892:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R4941:Deup1 UTSW 9 15588027 missense probably benign
R4959:Deup1 UTSW 9 15612014 nonsense probably null
R4960:Deup1 UTSW 9 15600968 missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15592428 missense probably damaging 0.99
R4973:Deup1 UTSW 9 15612014 nonsense probably null
R5195:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15575199 missense probably damaging 0.96
R5470:Deup1 UTSW 9 15582620 splice site probably null
R5931:Deup1 UTSW 9 15561322 missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15561256 missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15561342 missense probably damaging 0.99
R6516:Deup1 UTSW 9 15610614 missense probably damaging 0.99
R7948:Deup1 UTSW 9 15610648 missense possibly damaging 0.76
R8373:Deup1 UTSW 9 15592375 missense possibly damaging 0.80
R8725:Deup1 UTSW 9 15592425 missense probably damaging 1.00
R9008:Deup1 UTSW 9 15599844 missense probably damaging 0.99
R9462:Deup1 UTSW 9 15582586 missense probably benign 0.04
R9545:Deup1 UTSW 9 15607824 missense possibly damaging 0.95
Z1177:Deup1 UTSW 9 15600903 missense probably null 1.00
Z1177:Deup1 UTSW 9 15607832 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACTGTCACACTGTCATTGTG -3'
(R):5'- AGGACAGCAGCTCTGAGATC -3'

Sequencing Primer
(F):5'- ACACTGTCATTGTGCTGATGC -3'
(R):5'- AGCAGCTCTGAGATCCCTCG -3'
Posted On 2015-04-17