Incidental Mutation 'R0382:Vps41'
ID31035
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18827727 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 335 (H335N)
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect probably benign
Transcript: ENSMUST00000072961
AA Change: H335N

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236
AA Change: H335N

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222813
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0321:Vps41 UTSW 13 18842295 splice site probably benign
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2082:Vps41 UTSW 13 18852351 missense probably benign 0.27
R2147:Vps41 UTSW 13 18839734 splice site probably null
R2897:Vps41 UTSW 13 18810428 splice site probably benign
R4322:Vps41 UTSW 13 18823790 missense probably damaging 1.00
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R7790:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R8029:Vps41 UTSW 13 18823785 nonsense probably null
R8033:Vps41 UTSW 13 18810465 missense possibly damaging 0.94
R8241:Vps41 UTSW 13 18848998 missense possibly damaging 0.73
R8267:Vps41 UTSW 13 18810471 missense probably benign 0.00
R8801:Vps41 UTSW 13 18814233 missense possibly damaging 0.78
Z1177:Vps41 UTSW 13 18845935 missense probably benign 0.00
Z1177:Vps41 UTSW 13 18854595 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGACGCTGTGCCACTCATAAG -3'
(R):5'- AGCTGGTCTGATGGAACAACACAC -3'

Sequencing Primer
(F):5'- CAAGCTTTTAGAACTGAGGTCG -3'
(R):5'- TGAGCACTCTGATAGGATATGC -3'
Posted On2013-04-24