Incidental Mutation 'R3890:Specc1'
ID310354
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission 040802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3890 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62151913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 872 (T872M)
Ref Sequence ENSEMBL: ENSMUSP00000143853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202905]
Predicted Effect probably benign
Transcript: ENSMUST00000092415
AA Change: T801M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: T801M

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108709
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: T881M

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201015
AA Change: T221M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331
AA Change: T221M

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201364
AA Change: T872M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: T872M

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202179
AA Change: T792M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: T792M

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202389
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: T881M

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202905
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: T881M

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,554,700 Y201C probably damaging Het
Adam10 A G 9: 70,768,854 T624A probably benign Het
Atf2 T C 2: 73,863,213 S2G probably damaging Het
Atf7ip T C 6: 136,587,045 V762A possibly damaging Het
Cacna1e C T 1: 154,483,553 R265Q probably damaging Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Cntrl T G 2: 35,170,480 C1342G probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Dennd4a T C 9: 64,872,028 S598P probably damaging Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ect2 T C 3: 27,138,540 D387G probably damaging Het
Fam208b T C 13: 3,596,785 E80G probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fmo4 A T 1: 162,794,055 I529N probably benign Het
Frs3 A G 17: 47,703,435 D351G probably damaging Het
Gcat T A 15: 79,037,176 V378D probably damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Hspa4l A T 3: 40,781,594 Q570L possibly damaging Het
Ifi213 A G 1: 173,567,256 I571T probably benign Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mettl1 T C 10: 127,045,129 probably null Het
Mettl15 A G 2: 109,191,579 I127T probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Mobp G A 9: 120,167,956 C51Y probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myrip A G 9: 120,422,258 E210G probably damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pdgfra A G 5: 75,167,927 N240S probably null Het
Pdxdc1 T C 16: 13,836,448 T759A probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Prdm15 T C 16: 97,799,571 H829R probably damaging Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Rprd2 A T 3: 95,765,224 F956I probably damaging Het
Samd1 G A 8: 83,997,732 probably benign Het
Slc4a11 A T 2: 130,685,785 S592T probably damaging Het
Slc5a4b A G 10: 76,062,260 V540A probably benign Het
Slfn8 G A 11: 83,004,444 T512I possibly damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Sorl1 G A 9: 42,004,105 T1276M probably damaging Het
Speer4f1 T C 5: 17,479,502 I176T probably damaging Het
Spint1 T C 2: 119,248,802 I455T probably benign Het
Srp54a A G 12: 55,089,193 probably null Het
Stoml3 T A 3: 53,507,454 N222K probably damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tanc2 A T 11: 105,798,678 D222V probably damaging Het
Thsd7a G A 6: 12,418,337 S631L probably benign Het
Vmn2r73 G A 7: 85,857,936 H723Y probably benign Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TATTTTCAAAGCCTCCTGGGTG -3'
(R):5'- TTGCATCCACGCACACTGAG -3'

Sequencing Primer
(F):5'- CAAAGCCTCCTGGGTGTTCTG -3'
(R):5'- CACATTTGGCTCTAAAGGGC -3'
Posted On2015-04-17