Mutagenetix > Incidental Mutations

Incidental Mutation 'R3890:Specc1'

310354

Institutional Source

Beutler Lab

Gene Symbol

Specc1

Ensembl Gene

ENSMUSG00000042331

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms

Cytsb

MMRRC Submission

040802-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R3890 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61956763-62223013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62151913 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 872 (T872M)

Ref Sequence

ENSEMBL: ENSMUSP00000143853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202905]

Predicted Effect

probably benign
Transcript: ENSMUST00000092415
AA Change: T801M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: T801M

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	832	844	N/A	INTRINSIC
CH	883	981	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108709
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: T881M

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201015
AA Change: T221M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331
AA Change: T221M

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC
low complexity region	225	236	N/A	INTRINSIC
low complexity region	252	264	N/A	INTRINSIC
CH	303	401	1.4e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201364
AA Change: T872M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: T872M

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
CH	954	1052	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202179
AA Change: T792M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: T792M

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
CH	874	972	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202389
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: T881M

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202905
AA Change: T881M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: T881M

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,554,700	Y201C	probably damaging	Het
Adam10	A	G	9: 70,768,854	T624A	probably benign	Het
Atf2	T	C	2: 73,863,213	S2G	probably damaging	Het
Atf7ip	T	C	6: 136,587,045	V762A	possibly damaging	Het
Cacna1e	C	T	1: 154,483,553	R265Q	probably damaging	Het
Cckbr	A	C	7: 105,426,169	T49P	probably benign	Het
Clip2	T	C	5: 134,522,993	K92E	probably damaging	Het
Clrn3	T	C	7: 135,518,465	T131A	possibly damaging	Het
Cntrl	T	G	2: 35,170,480	C1342G	probably benign	Het
Def8	T	C	8: 123,458,344		probably benign	Het
Dennd4a	T	C	9: 64,872,028	S598P	probably damaging	Het
Deup1	A	G	9: 15,599,713	Y257H	probably damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Ect2	T	C	3: 27,138,540	D387G	probably damaging	Het
Fam208b	T	C	13: 3,596,785	E80G	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fmo4	A	T	1: 162,794,055	I529N	probably benign	Het
Frs3	A	G	17: 47,703,435	D351G	probably damaging	Het
Gcat	T	A	15: 79,037,176	V378D	probably damaging	Het
Hmcn1	A	T	1: 150,635,195	D3592E	probably damaging	Het
Hspa4l	A	T	3: 40,781,594	Q570L	possibly damaging	Het
Ifi213	A	G	1: 173,567,256	I571T	probably benign	Het
Lsamp	T	C	16: 39,984,692	V11A	probably benign	Het
Mettl1	T	C	10: 127,045,129		probably null	Het
Mettl15	A	G	2: 109,191,579	I127T	probably benign	Het
Mipep	T	C	14: 60,808,995	L322P	probably damaging	Het
Mob1b	T	A	5: 88,753,202	I156K	probably damaging	Het
Mobp	G	A	9: 120,167,956	C51Y	probably damaging	Het
Ms4a3	T	C	19: 11,632,907	N97S	probably benign	Het
Myrip	A	G	9: 120,422,258	E210G	probably damaging	Het
Nos1ap	T	C	1: 170,349,456	Y126C	probably damaging	Het
Nuak2	G	T	1: 132,331,485	A342S	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr170	A	G	16: 19,606,455	I71T	probably damaging	Het
Olfr58	T	G	9: 19,783,715	I194S	probably benign	Het
Olfr718-ps1	G	T	5: 143,137,397	S290R	probably benign	Het
Pdgfra	A	G	5: 75,167,927	N240S	probably null	Het
Pdxdc1	T	C	16: 13,836,448	T759A	probably benign	Het
Pex2	C	T	3: 5,560,948	C267Y	probably damaging	Het
Pgghg	T	C	7: 140,945,703	I473T	probably damaging	Het
Prdm15	T	C	16: 97,799,571	H829R	probably damaging	Het
Pum1	T	C	4: 130,764,082	L774P	probably damaging	Het
Rcbtb1	T	A	14: 59,228,355	H382Q	possibly damaging	Het
Rprd2	A	T	3: 95,765,224	F956I	probably damaging	Het
Samd1	G	A	8: 83,997,732		probably benign	Het
Slc4a11	A	T	2: 130,685,785	S592T	probably damaging	Het
Slc5a4b	A	G	10: 76,062,260	V540A	probably benign	Het
Slfn8	G	A	11: 83,004,444	T512I	possibly damaging	Het
Slx4	A	T	16: 3,979,909	I1537N	probably damaging	Het
Sorl1	G	A	9: 42,004,105	T1276M	probably damaging	Het
Speer4f1	T	C	5: 17,479,502	I176T	probably damaging	Het
Spint1	T	C	2: 119,248,802	I455T	probably benign	Het
Srp54a	A	G	12: 55,089,193		probably null	Het
Stoml3	T	A	3: 53,507,454	N222K	probably damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tanc2	A	T	11: 105,798,678	D222V	probably damaging	Het
Thsd7a	G	A	6: 12,418,337	S631L	probably benign	Het
Vmn2r73	G	A	7: 85,857,936	H723Y	probably benign	Het
Wdfy4	T	C	14: 33,047,280	E2076G	probably damaging	Het

Other mutations in Specc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Specc1	APN	11	62118009	missense	probably benign	0.02
IGL01953:Specc1	APN	11	62118296	missense	probably benign	0.40
IGL02244:Specc1	APN	11	62128368	missense	probably benign	0.41
IGL02257:Specc1	APN	11	62118417	missense	probably damaging	1.00
IGL02512:Specc1	APN	11	62118389	missense	probably damaging	1.00
IGL03147:Specc1	UTSW	11	62118282	missense	probably benign
R0039:Specc1	UTSW	11	62029369	missense	probably damaging	0.97
R0114:Specc1	UTSW	11	62146313	missense	possibly damaging	0.92
R0635:Specc1	UTSW	11	62118903	missense	probably damaging	1.00
R1514:Specc1	UTSW	11	62156532	missense	probably damaging	1.00
R1604:Specc1	UTSW	11	62043057	missense	probably damaging	1.00
R1717:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1719:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1739:Specc1	UTSW	11	62118818	nonsense	probably null
R1757:Specc1	UTSW	11	62119284	critical splice donor site	probably null
R1990:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R1991:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R2063:Specc1	UTSW	11	62118296	missense	probably benign	0.01
R2071:Specc1	UTSW	11	62117875	missense	probably damaging	0.98
R2245:Specc1	UTSW	11	62131887	missense	probably damaging	1.00
R3415:Specc1	UTSW	11	62118419	missense	probably benign	0.29
R3831:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R3891:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R4367:Specc1	UTSW	11	62118530	missense	probably damaging	1.00
R4489:Specc1	UTSW	11	62151827	splice site	probably null
R4580:Specc1	UTSW	11	62219331	missense	probably damaging	1.00
R4852:Specc1	UTSW	11	62211684	missense	probably damaging	1.00
R4930:Specc1	UTSW	11	62118958	missense	possibly damaging	0.93
R5016:Specc1	UTSW	11	62118957	missense	possibly damaging	0.92
R5416:Specc1	UTSW	11	62118909	missense	probably benign	0.00
R5650:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R6158:Specc1	UTSW	11	62118124	missense	probably damaging	0.99
R6329:Specc1	UTSW	11	62156553	missense	probably damaging	1.00
R6374:Specc1	UTSW	11	62156592	missense	possibly damaging	0.93
R6395:Specc1	UTSW	11	62132338	missense	probably damaging	1.00
R6653:Specc1	UTSW	11	62146418	missense	probably damaging	0.99
R6893:Specc1	UTSW	11	62132453	missense	probably benign
R6898:Specc1	UTSW	11	62118336	missense	probably benign
R7054:Specc1	UTSW	11	62117778	missense	probably damaging	0.96
R7294:Specc1	UTSW	11	62118337	missense	probably benign	0.01
R7376:Specc1	UTSW	11	62118252	missense	probably benign	0.06
R7560:Specc1	UTSW	11	62128409	critical splice donor site	probably null
R7605:Specc1	UTSW	11	62211680	missense	possibly damaging	0.91
R7621:Specc1	UTSW	11	62128384	missense	possibly damaging	0.96
R7804:Specc1	UTSW	11	62205397	missense	probably damaging	0.99
R7900:Specc1	UTSW	11	62219361	missense	probably damaging	1.00
R8310:Specc1	UTSW	11	62132345	missense	probably damaging	1.00
R8319:Specc1	UTSW	11	62118675	missense	possibly damaging	0.77
Z1177:Specc1	UTSW	11	62118767	missense	possibly damaging	0.86
Z1177:Specc1	UTSW	11	62205423	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TATTTTCAAAGCCTCCTGGGTG -3'
(R):5'- TTGCATCCACGCACACTGAG -3'

Sequencing Primer
(F):5'- CAAAGCCTCCTGGGTGTTCTG -3'
(R):5'- CACATTTGGCTCTAAAGGGC -3'

Posted On

2015-04-17