Mutagenetix > Incidental Mutation

Incidental Mutation 'R3890:Olfr170'

310367

Institutional Source

Beutler Lab

Gene Symbol

Olfr170

Ensembl Gene

ENSMUSG00000062245

Gene Name

olfactory receptor 170

Synonyms

GA_x54KRFPKG5P-16052703-16051765, MOR273-2

MMRRC Submission

040802-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R3890 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19605696-19611882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19606455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 71 (I71T)

Ref Sequence

ENSEMBL: ENSMUSP00000151806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]

AlphaFold

Q8VGL6

Predicted Effect

probably damaging
Transcript: ENSMUST00000078603
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: I70T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	308	1.5e-43	PFAM
Pfam:7tm_1	41	290	2.4e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000206562
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218837
AA Change: I71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1765

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,554,700	Y201C	probably damaging	Het
Adam10	A	G	9: 70,768,854	T624A	probably benign	Het
Atf2	T	C	2: 73,863,213	S2G	probably damaging	Het
Atf7ip	T	C	6: 136,587,045	V762A	possibly damaging	Het
Cacna1e	C	T	1: 154,483,553	R265Q	probably damaging	Het
Cckbr	A	C	7: 105,426,169	T49P	probably benign	Het
Clip2	T	C	5: 134,522,993	K92E	probably damaging	Het
Clrn3	T	C	7: 135,518,465	T131A	possibly damaging	Het
Cntrl	T	G	2: 35,170,480	C1342G	probably benign	Het
Def8	T	C	8: 123,458,344		probably benign	Het
Dennd4a	T	C	9: 64,872,028	S598P	probably damaging	Het
Deup1	A	G	9: 15,599,713	Y257H	probably damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Ect2	T	C	3: 27,138,540	D387G	probably damaging	Het
Fam208b	T	C	13: 3,596,785	E80G	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fmo4	A	T	1: 162,794,055	I529N	probably benign	Het
Frs3	A	G	17: 47,703,435	D351G	probably damaging	Het
Gcat	T	A	15: 79,037,176	V378D	probably damaging	Het
Hmcn1	A	T	1: 150,635,195	D3592E	probably damaging	Het
Hspa4l	A	T	3: 40,781,594	Q570L	possibly damaging	Het
Ifi213	A	G	1: 173,567,256	I571T	probably benign	Het
Lsamp	T	C	16: 39,984,692	V11A	probably benign	Het
Mettl1	T	C	10: 127,045,129		probably null	Het
Mettl15	A	G	2: 109,191,579	I127T	probably benign	Het
Mipep	T	C	14: 60,808,995	L322P	probably damaging	Het
Mob1b	T	A	5: 88,753,202	I156K	probably damaging	Het
Mobp	G	A	9: 120,167,956	C51Y	probably damaging	Het
Ms4a3	T	C	19: 11,632,907	N97S	probably benign	Het
Myrip	A	G	9: 120,422,258	E210G	probably damaging	Het
Nos1ap	T	C	1: 170,349,456	Y126C	probably damaging	Het
Nuak2	G	T	1: 132,331,485	A342S	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr58	T	G	9: 19,783,715	I194S	probably benign	Het
Olfr718-ps1	G	T	5: 143,137,397	S290R	probably benign	Het
Pdgfra	A	G	5: 75,167,927	N240S	probably null	Het
Pdxdc1	T	C	16: 13,836,448	T759A	probably benign	Het
Pex2	C	T	3: 5,560,948	C267Y	probably damaging	Het
Pgghg	T	C	7: 140,945,703	I473T	probably damaging	Het
Prdm15	T	C	16: 97,799,571	H829R	probably damaging	Het
Pum1	T	C	4: 130,764,082	L774P	probably damaging	Het
Rcbtb1	T	A	14: 59,228,355	H382Q	possibly damaging	Het
Rprd2	A	T	3: 95,765,224	F956I	probably damaging	Het
Samd1	G	A	8: 83,997,732		probably benign	Het
Slc4a11	A	T	2: 130,685,785	S592T	probably damaging	Het
Slc5a4b	A	G	10: 76,062,260	V540A	probably benign	Het
Slfn8	G	A	11: 83,004,444	T512I	possibly damaging	Het
Slx4	A	T	16: 3,979,909	I1537N	probably damaging	Het
Sorl1	G	A	9: 42,004,105	T1276M	probably damaging	Het
Specc1	C	T	11: 62,151,913	T872M	probably benign	Het
Speer4f1	T	C	5: 17,479,502	I176T	probably damaging	Het
Spint1	T	C	2: 119,248,802	I455T	probably benign	Het
Srp54a	A	G	12: 55,089,193		probably null	Het
Stoml3	T	A	3: 53,507,454	N222K	probably damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tanc2	A	T	11: 105,798,678	D222V	probably damaging	Het
Thsd7a	G	A	6: 12,418,337	S631L	probably benign	Het
Vmn2r73	G	A	7: 85,857,936	H723Y	probably benign	Het
Wdfy4	T	C	14: 33,047,280	E2076G	probably damaging	Het

Other mutations in Olfr170

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Olfr170	APN	16	19605921	missense	probably benign	0.00
IGL02002:Olfr170	APN	16	19606550	missense	possibly damaging	0.91
IGL02537:Olfr170	APN	16	19605799	missense	probably damaging	1.00
IGL02881:Olfr170	APN	16	19606300	missense	probably damaging	1.00
IGL03189:Olfr170	APN	16	19606591	missense	probably benign
R0012:Olfr170	UTSW	16	19606440	missense	probably benign	0.30
R0619:Olfr170	UTSW	16	19606272	missense	probably damaging	1.00
R0764:Olfr170	UTSW	16	19606432	missense	probably damaging	1.00
R1387:Olfr170	UTSW	16	19606027	missense	probably damaging	1.00
R1430:Olfr170	UTSW	16	19606002	missense	probably damaging	1.00
R1503:Olfr170	UTSW	16	19606312	missense	probably benign	0.19
R1878:Olfr170	UTSW	16	19605751	missense	probably benign
R1989:Olfr170	UTSW	16	19606657	missense	probably benign	0.00
R2012:Olfr170	UTSW	16	19606131	missense	probably benign	0.22
R3891:Olfr170	UTSW	16	19606455	missense	probably damaging	1.00
R5591:Olfr170	UTSW	16	19605858	missense	probably damaging	1.00
R6158:Olfr170	UTSW	16	19605925	missense	probably damaging	1.00
R6297:Olfr170	UTSW	16	19605930	missense	possibly damaging	0.81
R6512:Olfr170	UTSW	16	19606359	missense	probably damaging	1.00
R6962:Olfr170	UTSW	16	19605922	missense	probably benign	0.00
R7252:Olfr170	UTSW	16	19606499	missense	probably damaging	0.99
R7605:Olfr170	UTSW	16	19606272	missense	probably damaging	1.00
R7687:Olfr170	UTSW	16	19605735	missense	probably benign
R8302:Olfr170	UTSW	16	19606366	missense	probably benign	0.05
R8991:Olfr170	UTSW	16	19605761	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTACTGAAGTTATCCCTCATCAG -3'
(R):5'- AACGACTTCATCCTCTTGGG -3'

Sequencing Primer
(F):5'- GTTATCCCTCATCAGCACAGGGTAG -3'
(R):5'- GGACTGTTCTCTTCTTCAAAGACAAG -3'

Posted On

2015-04-17