Incidental Mutation 'R3891:Slc19a3'
ID310374
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83022957 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 113 (F113Y)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.4327 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAGTATGGCAGGTTCGTCAGG -3'
(R):5'- GTGTTGTGCTTCTGACCATACTTAC -3'

Sequencing Primer
(F):5'- GCAGGTTCGTCAGGGATAC -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'
Posted On2015-04-17