Incidental Mutation 'R3891:Rasef'
ID 310381
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
MMRRC Submission 040803-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R3891 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 73632816-73709231 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73698634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000062771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably benign
Transcript: ENSMUST00000058292
AA Change: V9A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102837
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,655,847 (GRCm39) T72A probably damaging Het
Ascc3 T A 10: 50,718,289 (GRCm39) I1994N probably damaging Het
C1qb A T 4: 136,607,727 (GRCm39) V212E probably damaging Het
Cfap54 T A 10: 92,874,708 (GRCm39) I563F possibly damaging Het
Clip2 T C 5: 134,551,847 (GRCm39) K92E probably damaging Het
Clrn3 T C 7: 135,120,194 (GRCm39) T131A possibly damaging Het
Col9a1 T C 1: 24,224,517 (GRCm39) probably null Het
Def8 T C 8: 124,185,083 (GRCm39) probably benign Het
Diaph1 C A 18: 38,033,691 (GRCm39) probably benign Het
Dmrta1 A T 4: 89,579,831 (GRCm39) I264F possibly damaging Het
Dscaml1 A T 9: 45,628,782 (GRCm39) D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,768,340 (GRCm39) S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 (GRCm39) Y4C probably damaging Het
Gm10088 T C 16: 18,847,001 (GRCm39) noncoding transcript Het
Gm5616 A G 9: 48,361,809 (GRCm39) noncoding transcript Het
H2-T24 T A 17: 36,326,330 (GRCm39) I190F possibly damaging Het
Hmcn1 A T 1: 150,510,946 (GRCm39) D3592E probably damaging Het
Il1rap A G 16: 26,495,606 (GRCm39) Y71C probably damaging Het
Krt1 T A 15: 101,758,847 (GRCm39) S106C unknown Het
Lsamp T C 16: 39,805,054 (GRCm39) V11A probably benign Het
Mob1b T A 5: 88,901,061 (GRCm39) I156K probably damaging Het
Naip2 T A 13: 100,297,606 (GRCm39) E810V probably damaging Het
Nfe2l1 A G 11: 96,710,823 (GRCm39) S181P possibly damaging Het
Nos1ap T C 1: 170,177,025 (GRCm39) Y126C probably damaging Het
Nuak2 G T 1: 132,259,223 (GRCm39) A342S possibly damaging Het
Or10ah1-ps1 G T 5: 143,123,152 (GRCm39) S290R probably benign Het
Or2aj5 A G 16: 19,425,205 (GRCm39) I71T probably damaging Het
Or2t1 T A 14: 14,328,114 (GRCm38) M1K probably null Het
Pcdhb16 A T 18: 37,612,422 (GRCm39) I461F probably benign Het
Pcdhga10 A C 18: 37,882,534 (GRCm39) H765P probably benign Het
Pex2 C T 3: 5,626,008 (GRCm39) C267Y probably damaging Het
Pgghg T C 7: 140,525,616 (GRCm39) I473T probably damaging Het
Polr2e G T 10: 79,873,213 (GRCm39) P80T probably benign Het
Pum1 T C 4: 130,491,393 (GRCm39) L774P probably damaging Het
Rpl13 A G 8: 123,831,907 (GRCm39) E201G probably damaging Het
Skint2 A G 4: 112,481,383 (GRCm39) E82G probably damaging Het
Skor2 A G 18: 76,946,350 (GRCm39) D24G unknown Het
Slc19a3 A T 1: 83,000,678 (GRCm39) F113Y probably damaging Het
Slc29a3 T A 10: 60,552,040 (GRCm39) K335* probably null Het
Slc30a6 T A 17: 74,726,541 (GRCm39) D282E probably benign Het
Slc9a7 A G X: 20,052,352 (GRCm39) F247S probably damaging Het
Slx4 A T 16: 3,797,773 (GRCm39) I1537N probably damaging Het
Specc1 C T 11: 62,042,739 (GRCm39) T872M probably benign Het
Stard10 G A 7: 100,993,137 (GRCm39) R231Q possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tesl1 A G X: 23,773,180 (GRCm39) Y227C probably damaging Het
Vwa1 T C 4: 155,857,651 (GRCm39) E49G probably damaging Het
Zc3h12a A G 4: 125,020,678 (GRCm39) F55S probably damaging Het
Zmym4 A G 4: 126,798,269 (GRCm39) I786T probably benign Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73,689,662 (GRCm39) nonsense probably null
IGL01329:Rasef APN 4 73,645,882 (GRCm39) missense probably damaging 1.00
IGL01517:Rasef APN 4 73,688,059 (GRCm39) missense probably benign 0.03
IGL02465:Rasef APN 4 73,652,725 (GRCm39) missense probably damaging 1.00
IGL02676:Rasef APN 4 73,677,966 (GRCm39) missense possibly damaging 0.69
IGL03137:Rasef APN 4 73,652,720 (GRCm39) nonsense probably null
IGL03403:Rasef APN 4 73,652,771 (GRCm39) missense probably damaging 1.00
BB001:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
BB011:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
P0033:Rasef UTSW 4 73,668,089 (GRCm39) missense probably benign 0.26
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0317:Rasef UTSW 4 73,666,799 (GRCm39) missense probably damaging 1.00
R0686:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R0987:Rasef UTSW 4 73,652,721 (GRCm39) nonsense probably null
R1115:Rasef UTSW 4 73,666,841 (GRCm39) missense possibly damaging 0.85
R1511:Rasef UTSW 4 73,653,985 (GRCm39) missense probably damaging 1.00
R1585:Rasef UTSW 4 73,658,574 (GRCm39) missense probably damaging 1.00
R1646:Rasef UTSW 4 73,652,786 (GRCm39) missense probably damaging 1.00
R1705:Rasef UTSW 4 73,662,301 (GRCm39) nonsense probably null
R1918:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R1919:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R3819:Rasef UTSW 4 73,677,942 (GRCm39) missense probably damaging 1.00
R3892:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R4344:Rasef UTSW 4 73,663,326 (GRCm39) missense probably damaging 1.00
R4491:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4492:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4594:Rasef UTSW 4 73,698,626 (GRCm39) missense possibly damaging 0.47
R4915:Rasef UTSW 4 73,649,696 (GRCm39) missense probably damaging 1.00
R5276:Rasef UTSW 4 73,654,004 (GRCm39) missense probably null 1.00
R5359:Rasef UTSW 4 73,689,565 (GRCm39) missense probably damaging 1.00
R5682:Rasef UTSW 4 73,659,208 (GRCm39) nonsense probably null
R5693:Rasef UTSW 4 73,688,076 (GRCm39) missense probably damaging 0.99
R6414:Rasef UTSW 4 73,658,818 (GRCm39) missense probably benign 0.13
R6543:Rasef UTSW 4 73,698,756 (GRCm39) intron probably benign
R6593:Rasef UTSW 4 73,663,327 (GRCm39) missense probably damaging 1.00
R7078:Rasef UTSW 4 73,698,626 (GRCm39) missense probably benign 0.01
R7083:Rasef UTSW 4 73,709,221 (GRCm39) missense probably benign 0.26
R7106:Rasef UTSW 4 73,645,864 (GRCm39) missense probably damaging 1.00
R7127:Rasef UTSW 4 73,662,369 (GRCm39) missense probably damaging 1.00
R7329:Rasef UTSW 4 73,662,374 (GRCm39) missense probably damaging 1.00
R7767:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R7891:Rasef UTSW 4 73,709,201 (GRCm39) missense probably benign
R7891:Rasef UTSW 4 73,677,935 (GRCm39) missense probably benign 0.00
R7924:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
R7997:Rasef UTSW 4 73,658,799 (GRCm39) missense possibly damaging 0.78
R8554:Rasef UTSW 4 73,645,844 (GRCm39) missense probably benign 0.03
R8832:Rasef UTSW 4 73,698,558 (GRCm39) intron probably benign
R8850:Rasef UTSW 4 73,645,840 (GRCm39) missense probably damaging 1.00
R8985:Rasef UTSW 4 73,708,960 (GRCm39) missense possibly damaging 0.48
R9093:Rasef UTSW 4 73,698,583 (GRCm39) missense probably benign 0.00
R9179:Rasef UTSW 4 73,662,356 (GRCm39) missense probably damaging 0.97
R9199:Rasef UTSW 4 73,658,625 (GRCm39) missense possibly damaging 0.88
R9300:Rasef UTSW 4 73,659,393 (GRCm39) missense probably benign
R9310:Rasef UTSW 4 73,653,956 (GRCm39) critical splice donor site probably null
R9415:Rasef UTSW 4 73,645,882 (GRCm39) missense probably benign 0.00
R9482:Rasef UTSW 4 73,708,933 (GRCm39) missense probably benign 0.00
R9719:Rasef UTSW 4 73,688,102 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTACCTTGCAGGAGAGAGG -3'
(R):5'- ACAAGGAAGTCATGCTAGTTGC -3'

Sequencing Primer
(F):5'- AGAGAGGTGACGCCCTTTC -3'
(R):5'- GGAAGTCATGCTAGTTGCTTAAC -3'
Posted On 2015-04-17