Incidental Mutation 'R3891:Pgghg'
ID310396
Institutional Source Beutler Lab
Gene Symbol Pgghg
Ensembl Gene ENSMUSG00000062031
Gene Nameprotein glucosylgalactosylhydroxylysine glucosidase
Synonyms5730511L01Rik, Athl1
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140941391-140947664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140945703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 473 (I473T)
Ref Sequence ENSEMBL: ENSMUSP00000128214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably benign
Transcript: ENSMUST00000026562
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079403
AA Change: I473T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031
AA Change: I473T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164580
AA Change: I473T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031
AA Change: I473T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Meta Mutation Damage Score 0.6876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Pgghg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Pgghg APN 7 140945351 critical splice donor site probably null
IGL00848:Pgghg APN 7 140942404 missense probably damaging 1.00
IGL01903:Pgghg APN 7 140946828 missense probably benign 0.03
IGL02060:Pgghg APN 7 140946633 missense probably benign 0.30
IGL02475:Pgghg APN 7 140945720 missense
IGL02519:Pgghg APN 7 140944981 missense possibly damaging 0.94
IGL02612:Pgghg APN 7 140946338 missense probably damaging 1.00
R0689:Pgghg UTSW 7 140943278 missense probably benign 0.08
R1696:Pgghg UTSW 7 140945311 missense possibly damaging 0.55
R1960:Pgghg UTSW 7 140943347 missense probably benign
R2110:Pgghg UTSW 7 140943540 missense possibly damaging 0.72
R3809:Pgghg UTSW 7 140945295 missense probably damaging 1.00
R3890:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R4622:Pgghg UTSW 7 140941496 splice site probably null
R5009:Pgghg UTSW 7 140943390 missense probably benign
R5058:Pgghg UTSW 7 140942542 missense possibly damaging 0.46
R5215:Pgghg UTSW 7 140946564 missense possibly damaging 0.64
R6122:Pgghg UTSW 7 140943395 missense possibly damaging 0.87
R6269:Pgghg UTSW 7 140946184 missense probably damaging 0.97
R6301:Pgghg UTSW 7 140946376 missense probably damaging 1.00
R6562:Pgghg UTSW 7 140946593 missense probably benign 0.01
R7054:Pgghg UTSW 7 140944718 missense probably benign 0.15
R7241:Pgghg UTSW 7 140945720 missense
R7320:Pgghg UTSW 7 140943040 missense probably benign 0.44
R7486:Pgghg UTSW 7 140942480 missense probably benign
R7665:Pgghg UTSW 7 140945469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCCTGGTCCAGAACAG -3'
(R):5'- AGCACAACATCTGCCTGCTTC -3'

Sequencing Primer
(F):5'- CAGGTCAGAAATATAACTTGCCCTTC -3'
(R):5'- ACCTCTTCTCCTGATTTGGGGG -3'
Posted On2015-04-17