Incidental Mutation 'R3891:Ascc3'
ID310401
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 040803-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50842193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1994 (I1994N)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably damaging
Transcript: ENSMUST00000035606
AA Change: I1994N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: I1994N

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217725
Meta Mutation Damage Score 0.2351 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 splice site probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50845700 missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R8021:Ascc3 UTSW 10 50731648 missense probably benign 0.02
R8134:Ascc3 UTSW 10 50767458 missense probably benign 0.02
R8252:Ascc3 UTSW 10 50642610 missense probably benign
R8348:Ascc3 UTSW 10 50618077 missense probably benign
R8351:Ascc3 UTSW 10 50849597 missense probably benign
R8356:Ascc3 UTSW 10 50649907 missense probably benign 0.38
R8362:Ascc3 UTSW 10 50642596 missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50649304 missense possibly damaging 0.93
R8448:Ascc3 UTSW 10 50618077 missense probably benign
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50718421 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAGTGGTAGTGATAGCTTAGAG -3'
(R):5'- GCCCTCTATATAAGTCATACAGTTCA -3'

Sequencing Primer
(F):5'- CACTGTCGTCATCTGACTA -3'
(R):5'- CTTGTGAGGCATCGAAGCTTACAC -3'
Posted On2015-04-17