Incidental Mutation 'R3891:Slc29a3'
ID310402
Institutional Source Beutler Lab
Gene Symbol Slc29a3
Ensembl Gene ENSMUSG00000020100
Gene Namesolute carrier family 29 (nucleoside transporters), member 3
Synonyms4933435C21Rik, Ent3
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60712072-60752794 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 60716261 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 335 (K335*)
Ref Sequence ENSEMBL: ENSMUSP00000112685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117513] [ENSMUST00000119595] [ENSMUST00000150845]
Predicted Effect probably null
Transcript: ENSMUST00000117513
AA Change: K335*
SMART Domains Protein: ENSMUSP00000112685
Gene: ENSMUSG00000020100
AA Change: K335*

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
Pfam:Nucleoside_tran 169 473 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119595
SMART Domains Protein: ENSMUSP00000112426
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144989
Predicted Effect probably benign
Transcript: ENSMUST00000150845
SMART Domains Protein: ENSMUSP00000119716
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lymphadenopathy, splenomegaly, histiocytic sarcoma, and premature death associated with extramedullary hematopoiesis, increased macrophage proliferation and apoptosis and abnormal lysosome function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Slc29a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc29a3 APN 10 60723817 missense possibly damaging 0.95
R1967:Slc29a3 UTSW 10 60716464 missense probably benign
R1986:Slc29a3 UTSW 10 60723814 missense probably damaging 1.00
R2206:Slc29a3 UTSW 10 60715907 missense possibly damaging 0.87
R4734:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4748:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4749:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R5682:Slc29a3 UTSW 10 60716212 missense probably benign 0.00
R5938:Slc29a3 UTSW 10 60752784 unclassified probably benign
R6104:Slc29a3 UTSW 10 60721002 missense possibly damaging 0.77
R6405:Slc29a3 UTSW 10 60716026 missense probably damaging 0.98
R7341:Slc29a3 UTSW 10 60750658 missense probably benign 0.25
R7683:Slc29a3 UTSW 10 60716366 missense not run
R8527:Slc29a3 UTSW 10 60730622 missense probably damaging 1.00
R8542:Slc29a3 UTSW 10 60730622 missense probably damaging 1.00
RF009:Slc29a3 UTSW 10 60750561 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCACCTTGGTCAAGTGTGAG -3'
(R):5'- TCTGGTGAAGACAACCCATCCC -3'

Sequencing Primer
(F):5'- CGGCTGGTAGTTACAGAGC -3'
(R):5'- ATCCCAGGATGCTCCCAG -3'
Posted On2015-04-17