Incidental Mutation 'R3891:Nfe2l1'
ID310407
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Namenuclear factor, erythroid derived 2,-like 1
SynonymsLCR-F1, TCF11, NRF1, TCF-11, Lcrf1
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96817414-96829968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96819997 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000131585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000142065] [ENSMUST00000167110] [ENSMUST00000167149] [ENSMUST00000169828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081775
AA Change: S469P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: S469P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107657
AA Change: S469P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: S469P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107658
AA Change: S469P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: S469P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107659
AA Change: S469P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615
AA Change: S469P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140138
Predicted Effect probably benign
Transcript: ENSMUST00000142065
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167110
AA Change: S311P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615
AA Change: S311P

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167149
AA Change: S469P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: S469P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169828
AA Change: S181P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615
AA Change: S181P

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Meta Mutation Damage Score 0.1337 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96817716 missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96827665 missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96820140 missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96822192 missense probably benign 0.04
R0218:Nfe2l1 UTSW 11 96827613 missense probably damaging 1.00
R0453:Nfe2l1 UTSW 11 96827368 missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96827688 missense probably damaging 1.00
R4108:Nfe2l1 UTSW 11 96819394 critical splice donor site probably null
R4234:Nfe2l1 UTSW 11 96819909 missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96827689 missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96822108 missense probably damaging 0.99
R5319:Nfe2l1 UTSW 11 96819379 missense probably damaging 0.98
R5929:Nfe2l1 UTSW 11 96827359 missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96817744 missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96820051 missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96827335 missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96827625 missense probably damaging 1.00
R6907:Nfe2l1 UTSW 11 96819810 missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96817720 missense probably benign 0.23
R7411:Nfe2l1 UTSW 11 96822183 missense probably benign 0.37
R7420:Nfe2l1 UTSW 11 96819913 missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96819796 missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96819445 missense probably damaging 1.00
R8134:Nfe2l1 UTSW 11 96819759 missense possibly damaging 0.83
R8252:Nfe2l1 UTSW 11 96819232 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATGATTGTGGCCCACATGC -3'
(R):5'- TGTTAGACGAAGCTATGCTGG -3'

Sequencing Primer
(F):5'- ATTGTGGCCCACATGCTCTAAGTAG -3'
(R):5'- GCTATGCTGGATGAGATCAGC -3'
Posted On2015-04-17