Incidental Mutation 'R3891:Olfr170'
ID310413
Institutional Source Beutler Lab
Gene Symbol Olfr170
Ensembl Gene ENSMUSG00000062245
Gene Nameolfactory receptor 170
SynonymsGA_x54KRFPKG5P-16052703-16051765, MOR273-2
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19605696-19611882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19606455 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 71 (I71T)
Ref Sequence ENSEMBL: ENSMUSP00000151806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
Predicted Effect probably damaging
Transcript: ENSMUST00000078603
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: I70T

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206562
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218837
AA Change: I71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Olfr170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Olfr170 APN 16 19605921 missense probably benign 0.00
IGL02002:Olfr170 APN 16 19606550 missense possibly damaging 0.91
IGL02537:Olfr170 APN 16 19605799 missense probably damaging 1.00
IGL02881:Olfr170 APN 16 19606300 missense probably damaging 1.00
IGL03189:Olfr170 APN 16 19606591 missense probably benign
R0012:Olfr170 UTSW 16 19606440 missense probably benign 0.30
R0619:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R0764:Olfr170 UTSW 16 19606432 missense probably damaging 1.00
R1387:Olfr170 UTSW 16 19606027 missense probably damaging 1.00
R1430:Olfr170 UTSW 16 19606002 missense probably damaging 1.00
R1503:Olfr170 UTSW 16 19606312 missense probably benign 0.19
R1878:Olfr170 UTSW 16 19605751 missense probably benign
R1989:Olfr170 UTSW 16 19606657 missense probably benign 0.00
R2012:Olfr170 UTSW 16 19606131 missense probably benign 0.22
R3890:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R5591:Olfr170 UTSW 16 19605858 missense probably damaging 1.00
R6158:Olfr170 UTSW 16 19605925 missense probably damaging 1.00
R6297:Olfr170 UTSW 16 19605930 missense possibly damaging 0.81
R6512:Olfr170 UTSW 16 19606359 missense probably damaging 1.00
R6962:Olfr170 UTSW 16 19605922 missense probably benign 0.00
R7252:Olfr170 UTSW 16 19606499 missense probably damaging 0.99
R7605:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R7687:Olfr170 UTSW 16 19605735 missense probably benign
R8302:Olfr170 UTSW 16 19606366 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTACTGAAGTTATCCCTCATCAGC -3'
(R):5'- TTAACGACTTCATCCTCTTGGG -3'

Sequencing Primer
(F):5'- GTTATCCCTCATCAGCACAGGGTAG -3'
(R):5'- GGACTGTTCTCTTCTTCAAAGACAAG -3'
Posted On2015-04-17