Mutagenetix > Incidental Mutations

Incidental Mutation 'R3891:Olfr170'

310413

Institutional Source

Beutler Lab

Gene Symbol

Olfr170

Ensembl Gene

ENSMUSG00000062245

Gene Name

olfactory receptor 170

Synonyms

GA_x54KRFPKG5P-16052703-16051765, MOR273-2

MMRRC Submission

040803-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R3891 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19605696-19611882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19606455 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 71 (I71T)

Ref Sequence

ENSEMBL: ENSMUSP00000151806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078603
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: I70T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	308	1.5e-43	PFAM
Pfam:7tm_1	41	290	2.4e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000206562
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218837
AA Change: I71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1765

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A3galt2	A	G	4: 128,762,054	T72A	probably damaging	Het
Ascc3	T	A	10: 50,842,193	I1994N	probably damaging	Het
C1qb	A	T	4: 136,880,416	V212E	probably damaging	Het
Cfap54	T	A	10: 93,038,846	I563F	possibly damaging	Het
Clip2	T	C	5: 134,522,993	K92E	probably damaging	Het
Clrn3	T	C	7: 135,518,465	T131A	possibly damaging	Het
Col9a1	T	C	1: 24,185,436		probably null	Het
Def8	T	C	8: 123,458,344		probably benign	Het
Diaph1	C	A	18: 37,900,638		probably benign	Het
Dmrta1	A	T	4: 89,691,594	I264F	possibly damaging	Het
Dscaml1	A	T	9: 45,717,484	D1112V	possibly damaging	Het
Ehbp1l1	A	G	19: 5,718,312	S988P	possibly damaging	Het
Gabrr2	A	G	4: 33,081,348	Y4C	probably damaging	Het
Gm10088	T	C	16: 19,028,251		noncoding transcript	Het
Gm4907	A	G	X: 23,906,941	Y227C	probably damaging	Het
Gm5616	A	G	9: 48,450,509		noncoding transcript	Het
H2-T24	T	A	17: 36,015,438	I190F	possibly damaging	Het
Hmcn1	A	T	1: 150,635,195	D3592E	probably damaging	Het
Il1rap	A	G	16: 26,676,856	Y71C	probably damaging	Het
Krt1	T	A	15: 101,850,412	S106C	unknown	Het
Lsamp	T	C	16: 39,984,692	V11A	probably benign	Het
Mob1b	T	A	5: 88,753,202	I156K	probably damaging	Het
Naip2	T	A	13: 100,161,098	E810V	probably damaging	Het
Nfe2l1	A	G	11: 96,819,997	S181P	possibly damaging	Het
Nos1ap	T	C	1: 170,349,456	Y126C	probably damaging	Het
Nuak2	G	T	1: 132,331,485	A342S	possibly damaging	Het
Olfr31	T	A	14: 14,328,114	M1K	probably null	Het
Olfr718-ps1	G	T	5: 143,137,397	S290R	probably benign	Het
Pcdhb16	A	T	18: 37,479,369	I461F	probably benign	Het
Pcdhga10	A	C	18: 37,749,481	H765P	probably benign	Het
Pex2	C	T	3: 5,560,948	C267Y	probably damaging	Het
Pgghg	T	C	7: 140,945,703	I473T	probably damaging	Het
Polr2e	G	T	10: 80,037,379	P80T	probably benign	Het
Pum1	T	C	4: 130,764,082	L774P	probably damaging	Het
Rasef	A	G	4: 73,780,397	V9A	probably benign	Het
Rpl13	A	G	8: 123,105,168	E201G	probably damaging	Het
Skint2	A	G	4: 112,624,186	E82G	probably damaging	Het
Skor2	A	G	18: 76,858,655	D24G	unknown	Het
Slc19a3	A	T	1: 83,022,957	F113Y	probably damaging	Het
Slc29a3	T	A	10: 60,716,261	K335*	probably null	Het
Slc30a6	T	A	17: 74,419,546	D282E	probably benign	Het
Slc9a7	A	G	X: 20,186,113	F247S	probably damaging	Het
Slx4	A	T	16: 3,979,909	I1537N	probably damaging	Het
Specc1	C	T	11: 62,151,913	T872M	probably benign	Het
Stard10	G	A	7: 101,343,930	R231Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Vwa1	T	C	4: 155,773,194	E49G	probably damaging	Het
Zc3h12a	A	G	4: 125,126,885	F55S	probably damaging	Het
Zmym4	A	G	4: 126,904,476	I786T	probably benign	Het

Other mutations in Olfr170

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Olfr170	APN	16	19605921	missense	probably benign	0.00
IGL02002:Olfr170	APN	16	19606550	missense	possibly damaging	0.91
IGL02537:Olfr170	APN	16	19605799	missense	probably damaging	1.00
IGL02881:Olfr170	APN	16	19606300	missense	probably damaging	1.00
IGL03189:Olfr170	APN	16	19606591	missense	probably benign
R0012:Olfr170	UTSW	16	19606440	missense	probably benign	0.30
R0619:Olfr170	UTSW	16	19606272	missense	probably damaging	1.00
R0764:Olfr170	UTSW	16	19606432	missense	probably damaging	1.00
R1387:Olfr170	UTSW	16	19606027	missense	probably damaging	1.00
R1430:Olfr170	UTSW	16	19606002	missense	probably damaging	1.00
R1503:Olfr170	UTSW	16	19606312	missense	probably benign	0.19
R1878:Olfr170	UTSW	16	19605751	missense	probably benign
R1989:Olfr170	UTSW	16	19606657	missense	probably benign	0.00
R2012:Olfr170	UTSW	16	19606131	missense	probably benign	0.22
R3890:Olfr170	UTSW	16	19606455	missense	probably damaging	1.00
R5591:Olfr170	UTSW	16	19605858	missense	probably damaging	1.00
R6158:Olfr170	UTSW	16	19605925	missense	probably damaging	1.00
R6297:Olfr170	UTSW	16	19605930	missense	possibly damaging	0.81
R6512:Olfr170	UTSW	16	19606359	missense	probably damaging	1.00
R6962:Olfr170	UTSW	16	19605922	missense	probably benign	0.00
R7252:Olfr170	UTSW	16	19606499	missense	probably damaging	0.99
R7605:Olfr170	UTSW	16	19606272	missense	probably damaging	1.00
R7687:Olfr170	UTSW	16	19605735	missense	probably benign
R8302:Olfr170	UTSW	16	19606366	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTACTGAAGTTATCCCTCATCAGC -3'
(R):5'- TTAACGACTTCATCCTCTTGGG -3'

Sequencing Primer
(F):5'- GTTATCCCTCATCAGCACAGGGTAG -3'
(R):5'- GGACTGTTCTCTTCTTCAAAGACAAG -3'

Posted On

2015-04-17