Incidental Mutation 'R3894:Olfr1387'
ID310457
Institutional Source Beutler Lab
Gene Symbol Olfr1387
Ensembl Gene ENSMUSG00000063386
Gene Nameolfactory receptor 1387
SynonymsMOR256-22, GA_x6K02T2QP88-5975166-5974231
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49455343-49464001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49459939 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 87 (G87R)
Ref Sequence ENSEMBL: ENSMUSP00000073494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073824] [ENSMUST00000214541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073824
AA Change: G87R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073494
Gene: ENSMUSG00000063386
AA Change: G87R

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1e-49 PFAM
Pfam:7tm_1 41 289 5.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214541
AA Change: G87R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Olfr1387
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr1387 APN 11 49460443 missense probably benign 0.05
IGL01511:Olfr1387 APN 11 49460216 missense probably damaging 1.00
IGL02322:Olfr1387 APN 11 49459957 missense probably benign 0.12
R1028:Olfr1387 UTSW 11 49460220 missense probably benign 0.03
R2173:Olfr1387 UTSW 11 49460140 missense probably benign 0.00
R5860:Olfr1387 UTSW 11 49459736 missense probably damaging 1.00
R6279:Olfr1387 UTSW 11 49460212 missense probably damaging 1.00
R6300:Olfr1387 UTSW 11 49460212 missense probably damaging 1.00
R6621:Olfr1387 UTSW 11 49459771 missense probably benign 0.09
R6836:Olfr1387 UTSW 11 49460077 missense possibly damaging 0.90
R6888:Olfr1387 UTSW 11 49460260 missense probably damaging 0.97
Z1088:Olfr1387 UTSW 11 49460456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCTCAACTGCAAGCC -3'
(R):5'- TCAGAGAGTTCACAAGGCCTCC -3'

Sequencing Primer
(F):5'- AACTGCAAGCCTTCCTTTTTG -3'
(R):5'- TCCCACCCAGGAGGAGATG -3'
Posted On2015-04-17