Incidental Mutation 'R3894:Gdf7'
ID310461
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Namegrowth differentiation factor 7
SynonymsBMP12
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R3894 (G1)
Quality Score135
Status Not validated
Chromosome12
Chromosomal Location8297918-8301954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8298845 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 151 (S151P)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: S159P
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: S159P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: S151P
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCGGAACAGACTCTCTTTC -3'
(R):5'- ATGTGTCTGGGGTAGCCAAG -3'

Sequencing Primer
(F):5'- TTTGCGTACGGGAGGAGATCAC -3'
(R):5'- GAAGCCAAGCTGCCCTC -3'
Posted On2015-04-17