Incidental Mutation 'R3894:Sdha'
ID310465
Institutional Source Beutler Lab
Gene Symbol Sdha
Ensembl Gene ENSMUSG00000021577
Gene Namesuccinate dehydrogenase complex, subunit A, flavoprotein (Fp)
SynonymsSDHF, FP, 2310034D06Rik, SDH2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74322254-74350280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74334391 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 268 (S268T)
Ref Sequence ENSEMBL: ENSMUSP00000022062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022062]
Predicted Effect probably benign
Transcript: ENSMUST00000022062
AA Change: S268T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022062
Gene: ENSMUSG00000021577
AA Change: S268T

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:FAD_binding_2 63 457 1.2e-128 PFAM
Pfam:Succ_DH_flav_C 512 664 3.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161086
Predicted Effect probably benign
Transcript: ENSMUST00000221594
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Sdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Sdha UTSW 13 74332247 missense probably damaging 1.00
R0480:Sdha UTSW 13 74327333 missense probably benign 0.36
R0960:Sdha UTSW 13 74323184 splice site probably benign
R1883:Sdha UTSW 13 74333136 missense probably damaging 0.98
R1884:Sdha UTSW 13 74333136 missense probably damaging 0.98
R2068:Sdha UTSW 13 74323968 splice site probably null
R3881:Sdha UTSW 13 74339192 missense probably damaging 1.00
R4063:Sdha UTSW 13 74323958 intron probably benign
R4384:Sdha UTSW 13 74326985 missense possibly damaging 0.89
R5046:Sdha UTSW 13 74327333 missense probably damaging 1.00
R5432:Sdha UTSW 13 74326949 missense probably damaging 0.97
R5521:Sdha UTSW 13 74350099 intron probably benign
R5645:Sdha UTSW 13 74323839 critical splice donor site probably null
R5770:Sdha UTSW 13 74323120 nonsense probably null
R5797:Sdha UTSW 13 74334357 missense probably damaging 1.00
R5920:Sdha UTSW 13 74326925 critical splice donor site probably null
R6450:Sdha UTSW 13 74334293 splice site probably null
R7677:Sdha UTSW 13 74333053 nonsense probably null
R7793:Sdha UTSW 13 74331436 missense probably damaging 1.00
R8284:Sdha UTSW 13 74331297 critical splice donor site probably null
Z1177:Sdha UTSW 13 74339632 missense probably damaging 1.00
Z1177:Sdha UTSW 13 74350193 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAACTCCCTGAGGACTCAAG -3'
(R):5'- CATCACAAGTATGGCCTCCC -3'

Sequencing Primer
(F):5'- TCCCTGAGGACTCAAGGTGGAG -3'
(R):5'- ACAAGTATGGCCTCCCACGTATTG -3'
Posted On2015-04-17