Mutagenetix > Incidental Mutations

Incidental Mutation 'R3894:Dnah1'

310466

Institutional Source

Beutler Lab

Gene Symbol

Dnah1

Ensembl Gene

ENSMUSG00000019027

Gene Name

dynein, axonemal, heavy chain 1

Synonyms

E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3894 (G1)

Quality Score

170

Status

Not validated

Chromosome

Chromosomal Location

31260375-31323896 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 31307028 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 582 (R582S)

Ref Sequence

ENSEMBL: ENSMUSP00000043281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048603]

Predicted Effect

probably benign
Transcript: ENSMUST00000048603
AA Change: R582S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: R582S

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DHC_N2	998	1404	6.3e-146	PFAM
AAA	1558	1697	6.02e-1	SMART
AAA	1839	2077	4.66e0	SMART
low complexity region	2149	2157	N/A	INTRINSIC
AAA	2204	2353	2.35e-1	SMART
Pfam:AAA_8	2533	2803	7.7e-84	PFAM
Pfam:MT	2815	3165	9.9e-57	PFAM
Pfam:AAA_9	3185	3410	1.1e-93	PFAM
Pfam:Dynein_heavy	3545	4246	2.7e-275	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt1s1	A	G	7: 44,853,939	D180G	probably damaging	Het
Aldh1a7	A	T	19: 20,696,398	Y457*	probably null	Het
Alpk3	C	T	7: 81,078,390	P423S	possibly damaging	Het
Aox2	A	T	1: 58,334,678		probably null	Het
Crebbp	T	C	16: 4,096,102	T1316A	probably benign	Het
Cul3	C	A	1: 80,283,690	V273F	probably damaging	Het
Fbxl2	T	C	9: 114,003,193	N51S	probably damaging	Het
Gapvd1	T	C	2: 34,728,476	D295G	probably benign	Het
Gdf7	A	G	12: 8,298,845	S151P	unknown	Het
Gm10277	T	C	11: 77,786,001		probably benign	Het
Hdac4	T	C	1: 91,970,968	E688G	possibly damaging	Het
Htr1d	A	G	4: 136,443,237	E259G	probably benign	Het
Ifi204	T	C	1: 173,749,208	H609R	possibly damaging	Het
Ift80	T	C	3: 68,917,999	D541G	probably damaging	Het
Il18r1	A	T	1: 40,474,874	H80L	possibly damaging	Het
Lrp4	G	A	2: 91,473,949	G158S	probably damaging	Het
Mesd	T	A	7: 83,897,785	L152H	probably damaging	Het
Morf4l1	A	T	9: 90,094,448	F276I	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mut	G	A	17: 40,955,139	C531Y	probably damaging	Het
Myo15	A	G	11: 60,504,319	T2480A	probably benign	Het
Olfr1284	C	A	2: 111,379,637	F212L	probably benign	Het
Olfr1317	T	C	2: 112,142,014	I23T	probably benign	Het
Olfr1387	G	A	11: 49,459,939	G87R	possibly damaging	Het
Olfr180	A	G	16: 58,916,339	F101L	probably benign	Het
Olfr437	A	T	6: 43,167,258	I67F	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Ovgp1	A	G	3: 105,986,596		probably benign	Het
Pcbp4	A	T	9: 106,461,371	Q59L	possibly damaging	Het
Prg4	G	C	1: 150,454,759		probably benign	Het
Rad50	T	A	11: 53,678,870	I905L	probably benign	Het
Rp1l1	T	C	14: 64,029,307	S781P	probably benign	Het
Rps3	C	T	7: 99,479,896	R173H	probably benign	Het
Rtn3	T	A	19: 7,435,085	T86S	probably damaging	Het
Sdha	A	T	13: 74,334,391	S268T	probably benign	Het
Sgo2b	A	T	8: 63,928,733	V355E	possibly damaging	Het
Sh3glb2	T	C	2: 30,355,288	T60A	probably damaging	Het
Slc26a3	A	C	12: 31,464,720	Y513S	probably damaging	Het
Slc35b2	T	C	17: 45,566,442	V165A	probably benign	Het
Slco3a1	A	G	7: 74,284,613	W604R	probably damaging	Het
Tet2	A	G	3: 133,469,477	S1370P	possibly damaging	Het
Tmtc4	A	T	14: 122,921,319		probably null	Het
Tsga13	A	G	6: 30,912,263	V18A	probably benign	Het
Ugt2a3	T	C	5: 87,329,590	T317A	probably benign	Het
Zcchc4	A	T	5: 52,784,100	D79V	probably damaging	Het

Other mutations in Dnah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Dnah1	APN	14	31287873	missense	probably benign	0.01
IGL00227:Dnah1	APN	14	31286896	missense	probably damaging	1.00
IGL00491:Dnah1	APN	14	31261839	missense	probably damaging	1.00
IGL00787:Dnah1	APN	14	31300063	missense	possibly damaging	0.91
IGL00809:Dnah1	APN	14	31300809	nonsense	probably null
IGL00911:Dnah1	APN	14	31304434	splice site	probably null
IGL00949:Dnah1	APN	14	31307090	missense	probably benign	0.00
IGL00976:Dnah1	APN	14	31278138	missense	probably damaging	1.00
IGL01484:Dnah1	APN	14	31299940	missense	probably damaging	0.98
IGL01629:Dnah1	APN	14	31292320	missense	probably damaging	1.00
IGL01716:Dnah1	APN	14	31263378	missense	probably benign	0.34
IGL01893:Dnah1	APN	14	31266470	missense	probably damaging	1.00
IGL01933:Dnah1	APN	14	31310915	missense	probably benign	0.40
IGL01938:Dnah1	APN	14	31283887	missense	probably benign
IGL02032:Dnah1	APN	14	31274369	missense	probably benign
IGL02052:Dnah1	APN	14	31268786	missense	probably damaging	0.99
IGL02097:Dnah1	APN	14	31305001	missense	possibly damaging	0.92
IGL02127:Dnah1	APN	14	31304928	missense	probably benign	0.00
IGL02143:Dnah1	APN	14	31283289	missense	probably damaging	1.00
IGL02158:Dnah1	APN	14	31300967	missense	probably benign	0.00
IGL02442:Dnah1	APN	14	31287878	missense	probably damaging	1.00
IGL02525:Dnah1	APN	14	31305833	missense	probably benign	0.05
IGL02558:Dnah1	APN	14	31274379	missense	possibly damaging	0.96
IGL02633:Dnah1	APN	14	31284815	missense	probably benign	0.05
IGL02720:Dnah1	APN	14	31262220	missense	probably damaging	0.96
IGL02728:Dnah1	APN	14	31283998	missense	probably benign	0.44
IGL02738:Dnah1	APN	14	31292640	missense	probably benign	0.27
IGL02863:Dnah1	APN	14	31295293	missense	probably damaging	0.99
IGL02944:Dnah1	APN	14	31300871	missense	possibly damaging	0.88
IGL03110:Dnah1	APN	14	31266717	missense	probably benign	0.40
IGL03201:Dnah1	APN	14	31300949	missense	probably benign	0.13
IGL03215:Dnah1	APN	14	31274391	missense	probably damaging	1.00
IGL03230:Dnah1	APN	14	31270066	missense	probably damaging	1.00
IGL03248:Dnah1	APN	14	31269889	missense	probably damaging	1.00
IGL03267:Dnah1	APN	14	31286588	missense	probably benign	0.00
IGL03299:Dnah1	APN	14	31315122	nonsense	probably null
IGL03301:Dnah1	APN	14	31292692	missense	probably damaging	1.00
ergonomic	UTSW	14	31300748	missense	possibly damaging	0.91
Faraday	UTSW	14	31310882	missense	probably null	0.05
K3955:Dnah1	UTSW	14	31266459	missense	probably benign
PIT1430001:Dnah1	UTSW	14	31262580	missense	probably damaging	1.00
PIT4382001:Dnah1	UTSW	14	31284455	missense	probably damaging	1.00
R0043:Dnah1	UTSW	14	31274405	missense	probably damaging	0.97
R0092:Dnah1	UTSW	14	31271609	missense	probably benign	0.00
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0101:Dnah1	UTSW	14	31283899	missense	probably damaging	1.00
R0119:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0136:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0144:Dnah1	UTSW	14	31267874	splice site	probably benign
R0279:Dnah1	UTSW	14	31302375	missense	possibly damaging	0.94
R0299:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0316:Dnah1	UTSW	14	31278151	missense	probably benign	0.00
R0739:Dnah1	UTSW	14	31265915	nonsense	probably null
R0789:Dnah1	UTSW	14	31304591	missense	probably benign
R0826:Dnah1	UTSW	14	31303907	missense	probably benign	0.02
R1102:Dnah1	UTSW	14	31296457	nonsense	probably null
R1116:Dnah1	UTSW	14	31307867	missense	probably benign	0.13
R1229:Dnah1	UTSW	14	31310851	missense	probably benign	0.11
R1447:Dnah1	UTSW	14	31306898	missense	probably benign	0.06
R1449:Dnah1	UTSW	14	31263951	missense	probably damaging	1.00
R1462:Dnah1	UTSW	14	31268781	splice site	probably benign
R1482:Dnah1	UTSW	14	31294874	missense	probably damaging	1.00
R1500:Dnah1	UTSW	14	31316758	missense	probably benign
R1512:Dnah1	UTSW	14	31293037	missense	probably damaging	1.00
R1591:Dnah1	UTSW	14	31272332	missense	probably benign	0.01
R1598:Dnah1	UTSW	14	31301262	missense	probably benign	0.07
R1644:Dnah1	UTSW	14	31302292	splice site	probably benign
R1672:Dnah1	UTSW	14	31276200	missense	probably damaging	1.00
R1713:Dnah1	UTSW	14	31279182	missense	probably damaging	1.00
R1769:Dnah1	UTSW	14	31310882	missense	probably null	0.05
R1796:Dnah1	UTSW	14	31261093	missense	probably benign	0.00
R1902:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1903:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1905:Dnah1	UTSW	14	31264630	missense	probably benign	0.06
R1908:Dnah1	UTSW	14	31262558	missense	probably damaging	1.00
R1972:Dnah1	UTSW	14	31265391	nonsense	probably null
R1973:Dnah1	UTSW	14	31265391	nonsense	probably null
R2004:Dnah1	UTSW	14	31301856	missense	possibly damaging	0.79
R2051:Dnah1	UTSW	14	31279123	missense	probably damaging	1.00
R2062:Dnah1	UTSW	14	31271129	missense	probably damaging	1.00
R2188:Dnah1	UTSW	14	31279164	missense	probably damaging	0.98
R2240:Dnah1	UTSW	14	31299974	missense	probably benign	0.00
R2862:Dnah1	UTSW	14	31284762	missense	probably benign	0.21
R2894:Dnah1	UTSW	14	31298761	missense	possibly damaging	0.67
R3120:Dnah1	UTSW	14	31266822	nonsense	probably null
R3410:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3411:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3435:Dnah1	UTSW	14	31316674	missense	probably damaging	0.96
R3615:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3616:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3741:Dnah1	UTSW	14	31265467	splice site	probably benign
R3805:Dnah1	UTSW	14	31294763	missense	possibly damaging	0.67
R4007:Dnah1	UTSW	14	31303784	splice site	probably benign
R4201:Dnah1	UTSW	14	31262270	missense	probably benign	0.00
R4232:Dnah1	UTSW	14	31304916	missense	probably benign
R4372:Dnah1	UTSW	14	31304922	missense	probably damaging	1.00
R4391:Dnah1	UTSW	14	31294835	missense	probably damaging	1.00
R4423:Dnah1	UTSW	14	31284761	missense	probably benign	0.00
R4526:Dnah1	UTSW	14	31285998	missense	probably benign	0.05
R4650:Dnah1	UTSW	14	31284887	splice site	probably null
R4723:Dnah1	UTSW	14	31272942	missense	probably damaging	1.00
R4748:Dnah1	UTSW	14	31319945	missense	probably benign
R4783:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4784:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4785:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4843:Dnah1	UTSW	14	31264963	missense	probably damaging	1.00
R4879:Dnah1	UTSW	14	31300748	missense	possibly damaging	0.91
R4897:Dnah1	UTSW	14	31267539	missense	probably damaging	1.00
R4911:Dnah1	UTSW	14	31295323	missense	probably damaging	1.00
R4985:Dnah1	UTSW	14	31286898	missense	probably null	1.00
R5070:Dnah1	UTSW	14	31282418	missense	probably benign	0.05
R5128:Dnah1	UTSW	14	31296195	splice site	probably null
R5409:Dnah1	UTSW	14	31263255	missense	probably damaging	1.00
R5436:Dnah1	UTSW	14	31316747	missense	probably benign
R5481:Dnah1	UTSW	14	31308871	missense	possibly damaging	0.55
R5550:Dnah1	UTSW	14	31316708	missense	probably benign	0.00
R5555:Dnah1	UTSW	14	31290819	missense	probably damaging	0.99
R5566:Dnah1	UTSW	14	31274366	missense	probably benign	0.35
R5623:Dnah1	UTSW	14	31286023	missense	possibly damaging	0.62
R5701:Dnah1	UTSW	14	31274044	missense	probably damaging	1.00
R5751:Dnah1	UTSW	14	31310906	missense	probably benign	0.00
R5823:Dnah1	UTSW	14	31266418	missense	possibly damaging	0.92
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6090:Dnah1	UTSW	14	31269425	missense	possibly damaging	0.83
R6139:Dnah1	UTSW	14	31286027	missense	probably benign	0.02
R6145:Dnah1	UTSW	14	31300970	missense	probably benign	0.07
R6306:Dnah1	UTSW	14	31304587	missense	probably damaging	0.97
R6376:Dnah1	UTSW	14	31275608	missense	probably damaging	1.00
R6451:Dnah1	UTSW	14	31300808	missense	probably benign	0.08
R6549:Dnah1	UTSW	14	31269383	missense	probably damaging	1.00
R6748:Dnah1	UTSW	14	31299988	missense	probably damaging	0.99
R6826:Dnah1	UTSW	14	31286290	missense	probably benign	0.00
R6870:Dnah1	UTSW	14	31271061	nonsense	probably null
R6932:Dnah1	UTSW	14	31287776	missense	probably damaging	1.00
R6944:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R7033:Dnah1	UTSW	14	31264925	missense	probably damaging	1.00
R7078:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R7133:Dnah1	UTSW	14	31286076	missense	probably benign
R7136:Dnah1	UTSW	14	31298656	missense	probably damaging	1.00
R7203:Dnah1	UTSW	14	31274382	missense	probably benign
R7241:Dnah1	UTSW	14	31264939	missense	probably benign	0.00
R7260:Dnah1	UTSW	14	31269386	missense	probably damaging	1.00
R7264:Dnah1	UTSW	14	31269894	missense	probably benign
R7291:Dnah1	UTSW	14	31298705	missense	probably damaging	1.00
R7293:Dnah1	UTSW	14	31287863	missense	probably damaging	1.00
R7300:Dnah1	UTSW	14	31269841	missense	probably benign	0.05
R7319:Dnah1	UTSW	14	31296594	missense	probably benign	0.02
R7323:Dnah1	UTSW	14	31298707	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31261590	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31300791	missense	possibly damaging	0.80
R7499:Dnah1	UTSW	14	31315122	nonsense	probably null
R7526:Dnah1	UTSW	14	31287876	missense	possibly damaging	0.49
R7560:Dnah1	UTSW	14	31304983	missense	probably benign
R7574:Dnah1	UTSW	14	31319908	missense	probably benign	0.00
R7617:Dnah1	UTSW	14	31284782	missense	possibly damaging	0.80
R7620:Dnah1	UTSW	14	31303906	missense	possibly damaging	0.47
R7692:Dnah1	UTSW	14	31292338	missense	probably benign	0.00
R7702:Dnah1	UTSW	14	31310909	missense	probably benign
R7786:Dnah1	UTSW	14	31262521	missense	probably damaging	1.00
R7984:Dnah1	UTSW	14	31267815	missense	probably damaging	1.00
R8002:Dnah1	UTSW	14	31298722	missense	probably damaging	1.00
R8022:Dnah1	UTSW	14	31265014	missense	probably damaging	1.00
R8032:Dnah1	UTSW	14	31271548	missense	probably damaging	1.00
R8099:Dnah1	UTSW	14	31302364	missense	probably benign	0.00
R8171:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R8263:Dnah1	UTSW	14	31293177	missense	probably damaging	1.00
R8274:Dnah1	UTSW	14	31295574	missense	probably benign	0.00
R8345:Dnah1	UTSW	14	31264594	missense	probably damaging	1.00
R8348:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8376:Dnah1	UTSW	14	31301346	missense	probably damaging	1.00
R8448:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8461:Dnah1	UTSW	14	31305958	missense	probably benign	0.00
RF006:Dnah1	UTSW	14	31307875	missense	probably benign	0.08
Z1088:Dnah1	UTSW	14	31304811	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCCAGACTCACTTGTAGGGG -3'
(R):5'- TGGCCATCCCAAGAACCTTG -3'

Sequencing Primer
(F):5'- GGCTGTTGACAAGGTCTTCCC -3'
(R):5'- GAACCTTGCTATATCATCTTCAAGC -3'

Posted On

2015-04-17