Incidental Mutation 'R3894:Tmtc4'
ID310468
Institutional Source Beutler Lab
Gene Symbol Tmtc4
Ensembl Gene ENSMUSG00000041594
Gene Nametransmembrane and tetratricopeptide repeat containing 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122918971-122984035 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 122921319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037726] [ENSMUST00000126867] [ENSMUST00000126867] [ENSMUST00000143189] [ENSMUST00000148661] [ENSMUST00000148661]
Predicted Effect probably null
Transcript: ENSMUST00000037726
SMART Domains Protein: ENSMUSP00000046368
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126494
Predicted Effect probably null
Transcript: ENSMUST00000126867
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126867
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143189
SMART Domains Protein: ENSMUSP00000116480
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148661
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148661
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228661
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Tmtc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Tmtc4 APN 14 122925954 splice site probably benign
IGL01408:Tmtc4 APN 14 122925954 splice site probably benign
IGL01487:Tmtc4 APN 14 122926031 missense probably benign 0.25
IGL01694:Tmtc4 APN 14 122973212 missense possibly damaging 0.92
IGL01934:Tmtc4 APN 14 122927635 nonsense probably null
IGL02456:Tmtc4 APN 14 122925962 critical splice donor site probably null
IGL03116:Tmtc4 APN 14 122927632 missense probably benign 0.02
IGL03326:Tmtc4 APN 14 122945540 missense probably damaging 0.99
PIT4403001:Tmtc4 UTSW 14 122973229 missense probably benign 0.01
R0344:Tmtc4 UTSW 14 122978160 missense probably damaging 1.00
R0630:Tmtc4 UTSW 14 122926090 splice site probably benign
R0849:Tmtc4 UTSW 14 122945554 missense possibly damaging 0.62
R1129:Tmtc4 UTSW 14 122943153 critical splice donor site probably null
R1601:Tmtc4 UTSW 14 122944826 missense probably benign 0.01
R1835:Tmtc4 UTSW 14 122941988 critical splice acceptor site probably null
R1966:Tmtc4 UTSW 14 122927599 missense probably benign 0.31
R2024:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2025:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2026:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2027:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2256:Tmtc4 UTSW 14 122941408 missense probably benign 0.09
R2439:Tmtc4 UTSW 14 122971903 missense probably damaging 1.00
R3001:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3002:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R4561:Tmtc4 UTSW 14 122963298 missense probably benign 0.21
R4926:Tmtc4 UTSW 14 122973206 missense probably damaging 1.00
R5000:Tmtc4 UTSW 14 122933331 missense possibly damaging 0.46
R5024:Tmtc4 UTSW 14 122941302 splice site probably null
R5104:Tmtc4 UTSW 14 122932845 missense probably damaging 0.99
R5200:Tmtc4 UTSW 14 122945557 missense probably benign 0.05
R5536:Tmtc4 UTSW 14 122932879 missense probably benign 0.09
R5677:Tmtc4 UTSW 14 122950499 missense probably damaging 1.00
R5768:Tmtc4 UTSW 14 122933153 missense possibly damaging 0.91
R6467:Tmtc4 UTSW 14 122925979 missense possibly damaging 0.80
R7317:Tmtc4 UTSW 14 122978181 missense probably benign 0.00
R7516:Tmtc4 UTSW 14 122943323 missense possibly damaging 0.68
R7539:Tmtc4 UTSW 14 122978289 splice site probably null
R7584:Tmtc4 UTSW 14 122978151 missense probably benign 0.01
R7821:Tmtc4 UTSW 14 122971877 missense probably benign
R7903:Tmtc4 UTSW 14 122927648 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGGGTCAGTATAGGTTACC -3'
(R):5'- GGTAGAGCTTACAGGCTTTGC -3'

Sequencing Primer
(F):5'- GGTCAGTATAGGTTACCTTTTAAACG -3'
(R):5'- GCCATCCCCTCTCTCTGG -3'
Posted On2015-04-17