Incidental Mutation 'R3894:Mslnl'
ID310471
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCATCAGAAGGGAGGTTTG -3'
(R):5'- CACAGGTCTGAAGCACTGAG -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On2015-04-17