Incidental Mutation 'R3894:Mut'
ID310472
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40955139 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 531 (C531Y)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169611]
Predicted Effect probably damaging
Transcript: ENSMUST00000169611
AA Change: C531Y

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: C531Y

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0603:Mut UTSW 17 40947166 missense probably damaging 0.99
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R2448:Mut UTSW 17 40958841 missense probably damaging 0.96
R3113:Mut UTSW 17 40958356 missense probably damaging 1.00
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5031:Mut UTSW 17 40938827 missense possibly damaging 0.96
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R5651:Mut UTSW 17 40947111 missense probably damaging 1.00
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGACTCCTGAGTAAATGTGTTAG -3'
(R):5'- GCAGAAGCAATGGTTTCCTTC -3'

Sequencing Primer
(F):5'- GGATCACAGAACATGATGG -3'
(R):5'- GCAGAAGCAATGGTTTCCTTCAGTAC -3'
Posted On2015-04-17