Incidental Mutation 'R3894:Slc35b2'
ID310473
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45566442 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041353
AA Change: V116A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: V116A

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
AA Change: V116A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably benign
Transcript: ENSMUST00000224905
AA Change: V165A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Gm10277 T C 11: 77,786,001 probably benign Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCAACTCTGAGGAAGTAGG -3'
(R):5'- TCCCATCATCATGACAGGGATC -3'

Sequencing Primer
(F):5'- CTCTGAGGAAGTAGGAAACAGACTTC -3'
(R):5'- CATCATCATGACAGGGATCACCTTG -3'
Posted On2015-04-17